Clin Exp Reprod Med Search

CLOSE


Clin Exp Reprod Med > Volume 52(1); 2025 > Article
Afshar, Nazarian, Fadaefathabadi, Aghajanpour, Soltani, Abdollahifar, Hassanzadeh, and Nourozian: Maternal exposure to phenanthrene induces testicular apoptosis and Sertoli cell dysfunction in F1 adult male mice: A histological and molecular study

Abstract

Objective

Phenanthrene, a polycyclic aromatic hydrocarbon, is found in abundance in environmental pollutants, food, and drinking water. This substance can accumulate in body tissues and exert harmful effects. Moreover, phenanthrene can cross the placental barrier, potentially impacting fetal development. We aimed to explore the impacts of maternal exposure to phenanthrene on testicular tissue and Sertoli cell function in F1 mice.

Methods

Female rats with vaginal plugs were randomly assigned to one of three groups: control, sham, or phenanthrene. The control group received no intervention during pregnancy. In the sham and phenanthrene groups, corn oil and a phenanthrene solution, respectively, were administered via gavage once every 2 days. Offspring were separated by sex 21 days after birth. At 56 days postnatal, male F1 offspring were euthanized, and their testes were harvested for histological and molecular analyses.

Results

Phenanthrene exposure was associated with a lower testicular weight and volume, a smaller diameter of the seminiferous tubules, and a relative thinning of the germinal epithelium. These changes were associated with increased cellular apoptosis, as shown by the upregulation of caspase 3 expression. Additionally, we observed an increase in vacuolization and residual bodies within the tissue. Conversely, the number of Sertoli cells and expression levels of Sox9, as well as the Ocln and Itgb1 genes, were found to be lowered.

Conclusion

Maternal exposure to phenanthrene impacts both germ cells and Sertoli cells, disrupting their function and leading to fertility disorders in male F1 offspring mice.

Introduction

Environmental pollution is a key cause of health problems and is recognized as a global concern. Estimates indicate that 91% of the world’s population resides in areas where the levels of micropollutants exceed the minimum standards set by the World Health Organization [1]. Among the various environmental pollutants, persistent organic pollutants are particularly concerning due to their long-lasting presence and their many adverse effects on human organs [2]. Polycyclic aromatic hydrocarbons (PAHs) are a class of stable organic pollutants produced during the incomplete combustion of organic materials. This can occur under conditions of high humidity, inappropriate temperature, and/or low oxygen levels. PAHs can be released into the environment naturally by volcanic eruptions and widespread fires, as well as through human activities such as industrial processes, diesel car emissions, smoking, and cooking. These compounds enter the human body via the respiratory system, during ingestion of food, and through the skin, posing a threat to health. PAHs that contain fewer than four benzene rings are classified as low-molecular-weight PAHs and can cross the placental barrier. Research indicates that maternal exposure to certain PAHs before birth is linked to a range of negative outcomes, including lower intelligence quotient, reduced head circumference, low birth weight, and intrauterine growth restriction [3]. Furthermore, studies have established positive relationships between PAH exposure and reproductive and developmental disorders, such as infertility, premature birth, low birth weight, and other adverse outcomes [4].
Phenanthrene (Phe), a low-molecular-weight PAH, is found on the list of 16 high-priority PAHs that are widely dispersed in the environment. With three benzene rings, Phe is derived from crude anthracene—a valuable industrial material. It is primarily used in the production of dyes, pesticides, and photoelectronic materials [5]. Additionally, Phe is prevalent in various vegetable and animal foods, grilled foods, drinking water, and polluted air, leading to its introduction into the human body and accumulation in various tissues [6]. Recent studies have focused on the toxic effects of Phe on male reproductive function. The findings indicate that long-term exposure to Phe can impair fertility by disrupting spermatogenesis, reducing the number of supporting and germ cells through increased apoptosis, while causing hormonal imbalances via the hypothalamus-pituitary-gonadal axis [7,8]. Furthermore, fetuses and infants can exhibit effects of Phe exposure, as the substance is found in the placenta, umbilical cord, and peripheral venous blood, as well as in the breast milk of pregnant or lactating women [9]. Research has demonstrated that exposure to Phe during pregnancy can lead to an increase in atresia of ovarian follicles in newborn mice [10].
The testicular tissue is composed of numerous seminiferous tubules, which are densely packed and separated by interstitial tissue. Histopathological examination of the testis serves as a crucial measure for assessing the impact of environmental toxins and pharmaceuticals. Spermatogenesis, a complex process that occurs within the seminiferous tubules, involves the transformation of diploid spermatogonia into haploid spermatids. This process is central to male fertility and relies on the support of Sertoli cells (SCs) and testosterone secreted from Leydig cells [11,12]. The absence of SCs, often referred to as the nurse cells of the testes, leads to infertility [13]. These cells are pivotal in the production and maturation of sperm, helping to form the blood-testis barrier, providing structural support, engaging in the phagocytosis of residual bodies, and secreting various critical molecules and hormones [14,15]. Given the prevalence of Phe in the environment, the increasing human exposure to this substance, and its known effects on fertility, a thorough investigation is warranted. Understanding the tissue and molecular damage caused by Phe can pave the way for improved diagnosis, prevention, and treatment of related disorders. Consequently, this study was designed to explore the effects of maternal exposure to Phe on the structure of testicular tissue and the function of SCs in adult male F1 mice.

Methods

1. Animals and study design

Twelve adult female mice (weight, 18.5±0.9 g; age, 6 weeks) and six adult male mice (weight, 25±1.4 g; age, 8 weeks) were acclimated to laboratory conditions for 1 week. The animals were housed at a temperature of 23±2 °C, with a humidity of 55%±5%, and subjected to a 12-hour light/dark cycle. The mice were given free access to food and water. Subsequently, mating was initiated at a ratio of two female mice:one male [16]. Each morning, the female mice were checked for the presence or absence of a vaginal plug. Those with vaginal plugs were designated as being at day 0.5 of pregnancy and were randomly assigned to one of three groups: control (Cont), sham, or Phe, with at least four mice per group. The Cont group received no intervention. The sham group was administered pure corn oil at a volume of 5 mL/kg, while the Phe group was given an oral Phe solution. In both sham and Phe groups, gavage was performed once every 2 days, totaling six administrations, until day 18.5 of pregnancy. At day 21 after birth, the F1 offspring were weaned and segregated into new cages by sex, where they remained until day 56. At the conclusion of this period, the mice were sacrificed using cervical dislocation. The right testis was excised for histological analysis, while the left testis was harvested for molecular testing.

2. Chemicals

Phe (CAS Number 85-01-8; 98% purity) was procured from Sigma Aldrich. The compound was dissolved in corn oil to prepare a Phe solution with a concentration of 12 μg/mL [10].

3. Testicular weighing

After removing the right testis, we cleared the surrounding connective tissues and weighed the testicular tissue fresh, using a digital scale accurate to 0.0001 g.

4. Tissue preparation

After collection, the samples were immersed in Bouin solution for 24 hours, followed by fixation in 10% formaldehyde for 5 days. Following the fixation period, the samples were dehydrated and were subsequently embedded in paraffin. Using a Leica Rm2125 RTS microtome (Leica Microsystems), the samples were serially sectioned. Sections with a thickness of 5 µm were prepared for qualitative examination of the tissue and SCs. The tissue samples were then stained with hematoxylin and eosin, mounted on slides, and examined under a light microscope. For the analysis, 10 sections from each animal were randomly selected.

5. Histomorphometry

Data were extracted using ImageJ (National Institutes of Health). Figures were captured from the slides with an optical microscope (Nikon) equipped with a Canon camera at three levels of magnification: ×4, ×10, and ×40.

6. Estimation of total testicular volume

The Cavalieri principle was applied in this assessment. Ten random sections at equal intervals were selected. These sections were then positioned on a volume measurement probe with the aid of a projecting microscope at a magnification of ×125. To calculate testicular volume, the probe featured 50 numbered points, which were randomly distributed across the sections. The tissue volume was estimated using the following formula:
V =P×ap×d
Here, d represents the section interval, while ΣP denotes the number of points counted. Additionally, the formula used to obtain 'a/p' is as follows: Δx and Δy represent the distances of the probe points on their respective axes, while M indicates magnification.
ap=y.x/M2

7. Thickness of seminiferous tubule epithelium

The epithelial thickness was assessed by measuring the distance from the basement membrane to the nearest spermatozoon within the lumen across 100 randomly selected tubules. These measurements were taken at four different angles [17].

8. Measurement of seminiferous tubule diameter

Seminiferous tubule diameters were measured at a magnification of ×10. For each sample, 10 seminiferous tubules were randomly selected from various locations. Within the tubular environment, 16 points were identified and connected by eight straight lines, ensuring that the center of the tubule intersected all lines. These intersections were used to calculate the tubule diameter in eight different directions, with the average diameter being reported. Only tubules that were cut transversely were considered acceptable for data inclusion. Furthermore, the cross-sectional shape of the tubules was nearly circular, with the two axes displaying a ratio close to 1:1.5.

9. Germinal epithelium vacuolization assessment

Clear, discrete spaces of large size, lacking a membrane covering, were identified as vacuolization within the epithelium. These vacuoles were found at various depths throughout the epithelial layer. ImageJ was utilized to examine the images and assess the extent of tissue vacuolization. An area fraction analysis was conducted to calculate the ratio of these spaces across the groups, and the findings were subsequently compared [18].

10. Estimation of SC number

SC counts were determined using the optical dissector method. For each sample, 10 sections were randomly selected based on the total number of tissue sections within a specific interval, employing systematic uniform random sampling. The cells were counted in a 20-µm-thick section. Images at ×40 magnification were positioned within a standard frame that had two exclusion sides and two inclusion sides. The characteristic morphology of pyramidal nuclei in SCs includes a shape that ranges from round to elongated, a pale appearance, and a size exceeding that of other nuclei, typically situated on the basement membrane. SCs located within the frame or touching the inclusion sides were counted and incorporated into the following formula:
Nv=QP×h×af×tBA
Here, a/f represents the frame area, h denotes the dissector height, BA stands for the microtome section thickness, T refers to the actual thickness of the section, ΣQ is the number of cells, and ΣP indicates the number of counted frame grids across all fields [19].

11. Voronoi tessellation

The Voronoi tessellation technique was employed to examine the distribution of cells within the tissue samples. It involved analyzing magnified ×40 texture images with the aid of plugins in the ImageJ program to delineate polygons. First, the cell nuclei were identified and marked. Subsequently, each polygon was defined as the area occupied by an individual cell. The software quantified the number and area of each polygon. To calculate the coefficient of variation (CV), which serves as a comparative index of cell distribution, the following formula was employed:
CV=standard deviation/mean×100.
The index is interpreted as indicating a regular (CV <33%), random (33%< CV <64%), or clustered (CV >64%) cell distribution [20].

12. Immunofluorescent staining

We examined the expression levels of SRY-box transcription factor 9 (Sox9), a marker for SCs, and cleaved caspase 3, a marker of the apoptotic cell rate. The slides were immersed in tris-buffered saline for 20 minutes. To permeabilize the membrane, samples were washed three times with phosphate-buffered saline (PBS) and treated with 0.3% Triton X-100 for 30 minutes. To block non-specific binding of the secondary antibody, 10% goat serum was added to the samples and incubated for 45 minutes. The samples were then incubated with the primary antibody, diluted in PBS, at 4 °C for 24 hours. After washing with PBS, the secondary antibody was added and incubated at 37 °C in the dark for 1.5 hours. The slides were subsequently washed and stained with 4′,6-diamidino-2-phenylindole (DAPI). To prepare for examination and microscopy (Olympus), glycerol was mixed with PBS and applied to the samples. ImageJ software was utilized to quantify the percentage of protein expression by measuring the level of fluorescence emission.

13. Analysis of Ocln and Itgb1 expression using real-time polymerase chain reaction

Following the removal of the left testis, the tissue was promptly transferred and stored at −80 °C. RNA samples were then extracted and treated with DNase I (Roche) to remove any genomic DNA contamination. Complementary DNA was synthesized using the Fermentas commercial kit, with the reaction performed at 42 °C for 60 minutes. Relative gene expression was quantified using real-time polymerase chain reaction (PCR; TaqMan) and the QuantiTect SYBR Green real-time PCR Kit (Takara Bio Inc.). Following PCR, the microtubes containing the reaction mixture were mixed before being placed in the PCR machine. The resulting data, including cycle threshold (CT) numbers, threshold cycles, and melting and proliferation curves for each gene, were analyzed. The CT numbers for the reference gene and the target genes of each sample were used to calculate relative expression changes using the 2−∆∆Ct method. Primer pairs for both forward and reverse primers were designed using Primer 3 Plus software. Before conducting the experiment, the PCR primers created with Primer 3 Plus were verified using the Primer-BLAST tool. The housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (Gapdh) served as the internal Cont (Table 1).

14. Statistical analysis

All quantitative data were analyzed using SPSS version 21 (IBM Corp.). Initially, the Shapiro-Wilk test was applied to assess the normal distribution of the data. Since the data were normally distributed, they were compared using one-way analysis of variance followed by the Tukey post hoc test. The results were expressed as mean±standard deviation. p-values of less than 0.05 were considered to indicate statistical significance. For graphical representations, GraphPad Prism 9 (GraphPad Software Inc.) was utilized. In cases where the data did not follow a normal distribution, the Kruskal-Wallis test was used.

15. Ethical considerations

The procedures received approval from the Research Ethics Committees for Laboratory Animals at Shahid Beheshti University of Medical Sciences, Tehran, Iran (Code: IR.SBMU.ACE.1402.040). This experimental research adhered to the ethical protocols outlined in the guidelines for working with laboratory animals.

Results

1. Testicular weight

Data analysis revealed that the testicular weight was significantly lower among the mice treated with Phe than in the Cont and sham groups (p<0.001 for both) (Figure 1A).

2. Total testicular volume

The total testicular volume in mice administered Phe was significantly lower than the volumes of both the Cont group and the sham group (p<0.0001 for both) (Figure 1B).

3. Thickness of the seminiferous tubule epithelium

The thickness of the spermatogenic epithelium in mice treated with Phe was significantly lower than in the Cont and sham groups (p<0.0001 for both) (Figure 2A, 2C).

4. Seminiferous tubule diameter

The diameter of the seminiferous tubules in the Phe group was significantly smaller than in both the Cont and sham groups (p<0.0001 for both). No significant difference was observed between the Cont and sham groups (Figure 2B, 2C).

5. Germinal epithelium vacuolization

Vacuole structures within the germinal epithelium were noted upon the analysis of tissue sections. Quantitative assessment of these vacuoles revealed a significantly higher degree of vacuolation in the germinal epithelium of mice treated with Phe compared to the Cont and sham groups (p<0.0001 for both) (Figure 3).

6. SC number

According to this assessment, the SC count was significantly lower in the Phe group than in the Cont and sham groups (p<0.0001 for both) (Figure 3C).

7. Voronoi tessellation

The mean polygon area in the Phe group was significantly larger than that of the sham and Cont groups (p<0.0001 for both). The analysis indicates that over 90% of the polygons in the sham and Cont groups were smaller than 80 µm2. In contrast, more than 50% of the polygons in the Phe group exceeded 100 µm2. Additionally, CV analysis demonstrated that the Phe group exhibited a random distribution of cells (33%< CV <64%), whereas the sham and Cont groups displayed a regular distribution (CV <33%) (Figures 4 and 5).

8. Seminiferous epithelium sloughing

Qualitative analysis of tissues stained with hematoxylin and eosin revealed that in the Phe group, the seminiferous epithelium was either completely or partially sloughed in some fields. Conversely, in the Cont and sham groups, the integrity of the epithelium was fully preserved (Figure 6A-6C).

9. Residual bodies

Residual bodies of various sizes were observed inside or near the lumen of the seminiferous tubules in the Phe group. These either are not absorbed by SCs or are absorbed with a delay, as indicated by qualitative analyses of tissues stained with hematoxylin and eosin. In the Cont and sham groups, such occurrences were rare (Figure 6D).

10. Immunofluorescent staining

Quantitative analysis of the Sox9 protein revealed that its expression was significantly lower in mice administered Phe compared to the Cont and sham groups (p<0.0001 for both) (Figure 7). Additionally, the expression of caspase 3 protein in the Phe group was significantly elevated compared to the other two groups (p<0.0001 for both) (Figure 8).

11. Real-time PCR analysis

The relative expression of messenger RNA for occludin (Ocln) and integrin subunit beta 1 (Itgb1) was quantified in the testicular tissue. Analysis revealed that gene expression was significantly downregulated in the Phe group relative to both the Cont and sham groups (p<0.01 for both) (Figure 9).

Discussion

Numerous studies have demonstrated the detrimental impacts of various types of PAHs on reproductive health. One PAH, benzo[a]pyrene, has been shown to damage testicular tissue prior to puberty [21]. Phe, like other PAHs, has been found to negatively affect a range of species, including mice, zebrafish, marine medaka, and Sebastiscus marmoratus [7,22,23]. These studies have confirmed the harmful effects of Phe on fertility by disrupting spermatogenesis. However, few investigations have explored the impact of maternal exposure to Phe on testicular development, especially in mammals. Therefore, the aim of this study was to investigate the effects of maternal exposure to Phe on SCs and testicular tissue in F1 adult male mice. Several studies have indicated that daily oral intake of Phe is strongly influenced by the type of food ingested. The concentration of Phe in various foods ranges from 0.2 to 91 µg/kg, and the estimated total intake of Phe through oral and inhalation routes is believed to be between 200 and 510 ng/kg body weight per day [24,25]. Based on these findings, the dose suggested for this research was 60 µg/kg every 2 days.
This study demonstrated that the administration of Phe decreased the weight and volume of the testes, as well as the diameter of the seminiferous tubules, the thickness of the germinal epithelium, and the total number of SCs. Additionally, it induced an increase in the vacuolization of the epithelium and the presence of residual bodies within the testes. Furthermore, Phe was shown to upregulate the expression of caspase 3 and downregulate the expression of the Sox9 protein, in addition to downregulating the expression of the Ocln and Itgb1 genes.
In this study, we observed a reduction in the diameter of the seminiferous tubules and a decrease in the thickness of the germinal epithelium. These changes may contribute to the observed reductions in testicular volume and weight. The diminished cell count following apoptosis could account for the decreased thickness and uniformity, as well as the increased vacuolization, observed in the epithelium [26]. Previous in vitro studies have shown that α-naphthoflavone and 9,10-dimethylbenzanthracene-3,4-dihydroodiol (DMBA-DHD) disrupt spermatogenesis by inhibiting meiosis and inducing apoptosis [27]. Similarly, Phe also diminished the number of testicular cells by inducing apoptosis, with the greatest effects seen in spermatogonia and SCs.
Examination of caspase-3 protein expression in the tissue revealed that Phe induces cellular toxicity and leads to cell death via activation of the apoptotic pathway. Caspase-3 expression, indicative of apoptosis, was observed across all cell lines. Previous research has indicated that the impact of Phe on germ cell mortality surpasses its effects on other cell lines [8]. The findings from Voronoi tessellation analysis corroborate these observations, demonstrating that Phe exposure results in an irregular cellular arrangement and an increase in the space allocated for individual cells within the tissue.
SCs are pivotal in the architecture and functionality of testicular tissue. These cells secrete a variety of factors and cytokines that influence the proliferation and differentiation of germ cells, facilitating sperm production. Characterized by their distinct cytoskeleton and asymmetrical shape, SCs establish the blood-testis barrier and, through the phagocytosis of antigens, preserve the integrity of the seminiferous tubules, which is essential for generating viable and normal sperm [28]. The present study demonstrated that exposure to Phe was associated with decreases in both the number of SCs and the expression of the Sox9 protein. Additionally, the findings revealed epithelial sloughing within the seminiferous tubules. This feature is a critical indicator of SC damage; as mentioned earlier, SCs are crucial for maintaining epithelial integrity. Research has shown that sloughing can result from cytoskeletal damage in SCs [29]. In such cases, the substance exerts a toxic effect on the cell by targeting tubulin, disrupting the polymerization of microtubules through direct binding. Damage to the SC cytoskeleton leads to the detachment of apical cells containing immature germ cells, which are then shed into the lumen. This process contributes to luminal blockage and impedes the release of sperm and seminal fluid [30].
Upon examination of the tissue slides, a substantial presence of residual bodies was noted within the seminiferous tubules of mice treated with Phe. These components, which are typically encountered during spermatogenesis, consist of cellular debris, lysosomes, mitochondria, and fragments of endoplasmic reticulum, enclosed within a membrane. Normally, SCs phagocytose and remove residual bodies. However, the presence of these elements in abnormally large quantities and at stages where they should not be present indicates damage to SC function and compromised phagocytic capability [31].
In mouse testicular tissue, Phe causes downregulation of the Ocln and Itgb1 genes, as evidenced by real-time PCR results. The Ocln gene encodes occludin, a 65-kDa protein that is essential for the formation and stability of tight junctions, which are critical components of the blood-testis barrier. This protein is expressed during all stages of spermatogenesis in SCs, and any disruption in its expression can compromise the barrier by increasing its permeability [32,33]. Research has indicated that bisphenol can cause damage to the dam across multiple generations by interfering with the expression of this gene [34].
Spermiation and natural sperm release are influenced by Itgb1, a gene that codes for β1 integrin and is involved in apical ectoplasmic specialization [35]. The presence of residual bodies in the lumen and the low expression of this gene suggest that sperm cannot undergo normal spermiogenesis, indicating damage to SCs. A limitation of this study is the lack of investigation into specific blood-testis barrier proteins and the failure to evaluate the SC structure using electron microscopy.
In conclusion, these findings suggest that maternal exposure to Phe induces apoptosis in offspring by stimulating caspase 3 expression, leading to vacuolation and a decrease in the thickness and diameter of spermatogenic tubules in the F1 generation. This apoptotic activity contributes to a reduction in the weight and volume of testicular tissue. Furthermore, stereological studies and the expression levels of the Sox9 protein indicate that maternal exposure to Phe results in the death of SCs by directly disrupting their structure and function. This disruption leads to the sloughing of the epithelium, the presence of residual bodies, and a decrease in the expression of genes associated with the blood-testis barrier and spermiogenesis in the F1 generation. Therefore, maternal exposure to Phe increases apoptosis and impairs SC function, causing tissue, cellular, and molecular damage in F1 offspring. These impacts can disrupt spermatogenesis and potentially lead to infertility.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This article is based on the PhD thesis of Azar Afshar and received financial support from the School of Medicine at Shahid Beheshti University of Medical Sciences in Tehran, Iran (Registration No: 43006892).

Author contributions

Conceptualization: GH, MN. Methodology: AA, GH, MN. Formal analysis: FA, RS, MAA. Data curation: AA, FF. Funding acquisition: MN. Project administration: GH, MN. Visualization: HN, FF, MAA. Writing-original draft: AA, FA, RS. Writing-review & editing: GH, MN. Approval of final manuscript: AA, HN, FF, FA, RS, MAA, GH, MN.

Figure 1.
(A) Mice receiving phenanthrene (Phe) exhibited a decrease in testicular weight. (B) Testicular volume was significantly lower in the Phe group compared to the other two groups. Cont, control. a)p<0.01; b)p<0.0001 (n=4).
cerm-2024-07038f1.jpg
Figure 2.
(A) The thickness of the germinal epithelium was significantly reduced in the phenanthrene (Phe) group. (B) The diameter of the seminiferous tubules was lower in rats receiving Phe. (C) An image of testicular tissue at ×10 magnification demonstrates the method for measuring the thickness of the epithelium (purple lines) and the diameter of the tubules (red lines). Cont, control. a)p<0.001; b)p<0.0001 (n=4).
cerm-2024-07038f2.jpg
Figure 3.
(A) Vacuolization in the seminiferous tubules was significantly elevated following phenanthrene (Phe) administration. (B) Testicular tissue image at ×40 magnification, with vacuole spaces indicated by white arrowheads. (C) A reduced number of Sertoli cells (SCs) was observed in rats treated with Phe. (D) Image of testicular tissue at ×40 magnification used for cell counting, showing exclusion (green) and inclusion (red) lines, as well as SCs (indicated by black arrows). a)p<0.001; b)p<0.0001 (n=4).
cerm-2024-07038f3.jpg
Figure 4.
Micrograph of cells and schematic of Voronoi tessellation in seminiferous tubules. (A, B) Control group. (C, D) Sham group. (E, F) Phenanthrene group.
cerm-2024-07038f4.jpg
Figure 5.
Evaluation of the spatial pattern of testicular cells using Voronoi tessellation. (A) The mean area of the Voronoi polygons in the phenanthrene (Phe) group was significantly decreased. (B) The coefficient of variation (CV) in the Phe group indicates a random arrangement of cells. (C) The distribution of Voronoi polygon areas reveals a difference between groups. Cont, control. a)p<0.05; b)p<0.01; c)p<0.0001 (n=5).
cerm-2024-07038f5.jpg
Figure 6.
(A, B, C) Seminiferous epithelium sloughing. (A, B) Control and sham groups, respectively. No evidence of sloughing is apparent in these tubules. (C) In the phenanthrene (Phe) group, the tubules have undergone complete (black arrow) or partial (white arrow) sloughing. The figures were captured at a magnification of ×10. (D) Atypical residual bodies (blue arrows) are present in the seminiferous tubules of the Phe group.
cerm-2024-07038f6.jpg
Figure 7.
(A) The expression of SRY-box transcription factor 9 (Sox9) was significantly lowered in mice receiving phenanthrene (Phe). Photomicrographs obtained from immunofluorescent staining: (B, C, D) control (Cont) group, (E, F, G) sham group, and (H, I, J) Phe group. DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.0001 (n=5).
cerm-2024-07038f7.jpg
Figure 8.
(A) Expression of caspase-3 was higher in the phenanthrene (Phe) group than in the other groups. Photomicrographs obtained from immunofluorescent staining: (B, C, D) control (Cont) group, (E, F, G) sham group, and (H, I, J) Phe group. a)p<0.0001 (n=5).
cerm-2024-07038f8.jpg
Figure 9.
Administration of phenanthrene (Phe) upregulated the expression of multiple genes. (A) Occludin (Ocln). (B) Integrin subunit beta 1 (Itgb1). Cont, control. a)p<0.01 (n=5).
cerm-2024-07038f9.jpg
Table 1.
Primer design
Gene Primer sequences Product length (bp)
Ocln Forward: AGTTGTGGGAGAAGGGAGAGG 156
Reverse: ACTGGAGATAGGAAAGTGATGGA
Itgb1 Forward: CACCCGAGACCAACCGAGAAG 181
Reverse: CCAATCCAGGAAACCAGTTGC
Gapdh Forward: CAGAACATCATCCCAGCCTCC 152
Reverse: TTGGCAGGTTTCTCAAGACGG

Ocln, occluding; Itgb1, integrin subunit beta 1; Gapdh, gene glyceraldehyde 3-phosphate dehydrogenase; bp, base pairs.

References

1. Cohen AJ, Brauer M, Burnett R, Anderson HR, Frostad J, Estep K, et al. Estimates and 25-year trends of the global burden of disease attributable to ambient air pollution: an analysis of data from the Global Burden of Diseases Study 2015. Lancet 2017;389:1907-18.
crossref pmid pmc
2. Liu C, Hou HS. Physical exercise and persistent organic pollutants. Heliyon 2023;9:e19661.
crossref pmid pmc
3. Khalili Doroodzani A, Dobaradaran S, Akhbarizadeh R, Raeisi A, Rahmani E, Mahmoodi M, et al. Diet, exposure to polycyclic aromatic hydrocarbons during pregnancy, and fetal growth: a comparative study of mothers and their fetuses in industrial and urban areas in Southwest Iran. Environ Pollut 2021;276:116668.
crossref pmid
4. Dejmek J, Solansky I, Benes I, Lenicek J, Sram RJ. The impact of polycyclic aromatic hydrocarbons and fine particles on pregnancy outcome. Environ Health Perspect 2000;108:1159-64.
crossref pmid pmc
5. Sainaba AB, Venkateswarulu M, Bhandari P, Arachchige KS, Clegg JK, Mukherjee PS. An adaptable water-soluble molecular boat for selective separation of phenanthrene from isomeric anthracene. J Am Chem Soc 2022;144:7504-13.
crossref pmid pdf
6. Guo J, Huang J, Wang Q, Fang L, Zhang S, Li B, et al. Maternal exposure to phenanthrene during gestation disturbs glucose homeostasis in adult mouse offspring. Chemosphere 2021;270:128635.
crossref pmid
7. Chen Y, Zhang Y, Yu Z, Guan Y, Chen R, Wang C. Early-life phenanthrene exposure inhibits reproductive ability in adult zebrafish and the mechanism of action. Chemosphere 2021;272:129635.
crossref pmid
8. Huang J, Fang L, Zhang S, Zhang Y, Ou K, Wang C. Long-term exposure to environmental levels of phenanthrene disrupts spermatogenesis in male mice. Environ Pollut 2021;285:117488.
crossref pmid
9. Yu Y, Wang X, Wang B, Tao S, Liu W, Wang X, et al. Polycyclic aromatic hydrocarbon residues in human milk, placenta, and umbilical cord blood in Beijing, China. Environ Sci Technol 2011;45:10235-42.
crossref pmid
10. Guo J, Guo W, Zhang T, Zheng Y, Han B, Zhang Z, et al. Gestational exposure to phenanthrene induces follicular atresia and endocrine dyscrasia in F1 adult female. Ecotoxicol Environ Saf 2022;232:113291.
crossref pmid
11. Suede SH, Malik A, Sapra A. Histology, spermatogenesis. In: StatPearls, editor. StatPearls Publishing; 2020. Available from: https://pubmed.ncbi.nlm.nih.gov/31985935

12. Poorhassan M, Navae F, Mahakizadeh S, Bazrafkan M, Nikmehr B, Abolhassani F, et al. Flaxseed can reduce hypoxia-induced damages in rat testes. Int J Fertil Steril 2018;12:235-41.
pmid pmc
13. Lancaster K, Trauth SE, Gribbins KM. Testicular histology and germ cell cytology during spermatogenesis in the Mississippi map turtle, Graptemys pseudogeographica kohnii, from Northeast Arkansas. Spermatogenesis 2015;4:e992654.
crossref pmid pmc
14. Wong WJ, Khan YS. Histology, sertoli cell. In: StatPearls, editor. StatPearls Publishing; 2020. Available from: https://pubmed.ncbi.nlm.nih.gov/32809466

15. Choobineh H, Sadighi Gilani MA, Pasalar P, Jahanzad I, Ghorbani R, Hassanzadeh G. The effects of testosterone on oxidative stress markers in mice with spinal cord injuries. Int J Fertil Steril 2016;10:87-93.
pmid pmc
16. Lohmiller JJ, Swing SP, Hanson MM. Reproduction and breeding. In: Suckow MA, Hankenson FC, Wilson RP, Foley PL, editors. The laboratory rat. 3rd ed. Elsevier; 2020. p. 157-79.

17. Yalcin T, Kaya S, Tektemur NK, Ozan İE. The methods used in histopathological evaluation of testis tissues. Batman Univ Yasam Bilim Derg 2020;10:148-57.

18. Mahmoudi A, Hadrich F, Bouallagui Z, Feki I, Ghorbel H, Ayadi L, et al. Comparative study of the effect of oleuropein and hydroxytyrosol rich extracts on the reproductive toxicity induced by bisphenol A in male rats: biochemical, histopathological, and molecular analyses. Environ Sci Pollut Res Int 2023;30:78735-49.
crossref pmid pdf
19. Ghaffari Novin M, Sabbagh Alvani M, Mafi Balani M, Aliaghaei A, Afshar A, Aghajanpour F, et al. Therapeutic effects of edaravone on azoospermia: free radical scavenging and autophagy modulation in testicular tissue of mice. J Reprod Infertil 2022;23:73-83.
crossref pmid pmc
20. Aryan A, Aghajanpour F, Dashtdar M, Hejazi F, Salimi M, Afshar A, et al. Exploring intercellular dynamics: ultra-weak biophoton emission as a novel indicator of altered cell functions and disease in oligospermia mice. J Lasers Med Sci 2023;14:e65.
crossref pmid pmc pdf
21. Xu A, Wang J, Wang H, Sun Y, Hao T. Protective effect of lycopene on testicular toxicity induced by Benzo[a]pyrene intake in rats. Toxicology 2019;427:152301.
crossref pmid
22. Zheng Y, Li Y, Yue Z, Samreen , Li Z, Li X, et al. Teratogenic effects of environmentally relevant concentrations of phenanthrene on the early development of marine medaka (Oryzia melastigma). Chemosphere 2020;254:126900.
crossref pmid
23. Lin W, Huang Z, Zhang W, Ren Y. Investigating the neurotoxicity of environmental pollutants using zebrafish as a model organism: a review and recommendations for future work. Neurotoxicology 2023;94:235-44.
crossref pmid
24. Sampaio GR, Guizellini GM, da Silva SA, de Almeida AP, Pinaffi-Langley AC, Rogero MM, et al. Polycyclic aromatic hydrocarbons in foods: biological effects, legislation, occurrence, analytical methods, and strategies to reduce their formation. Int J Mol Sci 2021;22:6010.
crossref pmid pmc
25. Bansal V, Kim KH. Review of PAH contamination in food products and their health hazards. Environ Int 2015;84:26-38.
crossref pmid
26. Picut CA, Ziejewski MK, Stanislaus D. Comparative aspects of pre- and postnatal development of the male reproductive system. Birth Defects Res 2018;110:190-227.
crossref pmid pdf
27. Zhang Y, Dong S, Wang H, Tao S, Kiyama R. Biological impact of environmental polycyclic aromatic hydrocarbons (ePAHs) as endocrine disruptors. Environ Pollut 2016;213:809-24.
crossref pmid
28. O’Donnell L, Smith LB, Rebourcet D. Sertoli cells as key drivers of testis function. Semin Cell Dev Biol 2022;121:2-9.
crossref pmid
29. McClusky LM, Nielsen J. A histological study of the protracted dismantling of the spent (Sertoli‐only) shark spermatocyst post‐spermiation: insight from species with or without testis‐associated lymphomyeloid tissue. Anat Histol Embryol 2024;53:e13017.
crossref
30. Johnson KJ. Testicular histopathology associated with disruption of the Sertoli cell cytoskeleton. Spermatogenesis 2015;4:e979106.
crossref pmid pmc
31. Thumfart KM, Mansuy IM. What are Sertoli cells?: historical, methodological, and functional aspects. Andrology 2023;11:849-59.
crossref pmid pdf
32. Jiang XH, Bukhari I, Zheng W, Yin S, Wang Z, Cooke HJ, et al. Blood-testis barrier and spermatogenesis: lessons from genetically-modified mice. Asian J Androl 2014;16:572-80.
crossref pmid pmc
33. Aghajanpour F, Soltani R, Afshar A, Abbaszadeh HA, Fadaei Fathabadi F, Moeinian N, et al. Sertoli cell-conditioned medium can improve blood-testis-barrier function and spermatogenesis in azoospermia mice induced by scrotal hyperthermia: an experimental study. Int J Reprod Biomed 2024;22:17-30.
crossref pmid pmc
34. Adegoke EO, Rahman MS, Amjad S, Pang WK, Ryu DY, Park YJ, et al. Bisphenol A damages testicular junctional proteins transgenerationally in mice. Environ Pollut 2022;302:119067.
crossref pmid
35. Zhang DC, Chen R, Cai YH, Wang JJ, Yin C, Zou K. Hyperactive reactive oxygen species impair function of porcine Sertoli cells via suppression of surface protein ITGB1 and connexin-43. Zool Res 2020;41:203-7.
crossref pmid pmc
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 4 Web of Science
  • 3 Crossref
  • 3 Scopus
  • 4,080 View
  • 85 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next