Clin Exp Reprod Med Search

CLOSE


Clin Exp Reprod Med > Volume 52(4); 2025 > Article
Sharifi, Boroujeni, Haratian, Sabbaghian, and Meybodi: WT1 pathogenic variant in azoospermic infertile men with an isolated undescended testis

Abstract

Objective

An undescended testis (UDT) is a testicle that has not moved into the scrotum before birth. UDTs are linked to reduced fertility, primarily due to compromised semen quality and potential dysfunction in Sertoli and Leydig cells. Additionally, the Wilms tumor 1 (WT1) gene is crucial for spermatogenesis, as it regulates the polarity of Sertoli cells and the steroidogenesis in Leydig cells. Our study aimed to identify novel UDT-causing WT1 variants within a cohort of 60 unrelated men with infertile hypergonadotropic hypogonadism.

Methods

In this case-control study, the coding regions and the intronic boundaries of the second and ninth exon of WT1 were sequenced using Sanger sequencing. DNA from 60 fertile men served as the control group. In silico analysis of the variants was also conducted.

Results

The study identified multiple intronic and exonic variations in both the patient and control groups. Notably, a haplotype consisting of two heterozygous C>T variations in the intronic region of the splice donor site of exon 9 was observed in 11 patients but was absent in the control group. Of these variations, only one has been previously reported in Single Nucleotide Polymorphism Database (dbSNP) as rs587776576 (NC_000011.10: g.32391967C>T; NM_000378.4:c.1372+14G>A).

Conclusion

The rs587776576 mutation is pathogenic. It exhibited a significant association (p=0.022), indicating its association with infertility and UDT in the Iranian population. This research could broaden the spectrum of WT1 variations and underscore the importance of these variants in the genetic etiology of UDT and infertility. These findings provide a foundation for clinical diagnosis and genetic counseling.

Introduction

Infertility is a significant global health issue defined by a couple's inability to conceive after 1 year of unprotected intercourse. Each year, about 15% of couples encounter infertility challenges [1]. Male factor infertility accounts for 50% of these cases [1-3]. This condition is a complex syndrome that includes various disorders [4]. One such disorder, related to pre-testicular factors, is cryptorchidism or undescended testis (UDT), which affects 1% to 9% of full-term boys [5]. Testicular descent occurs in two phases: an androgen-independent first phase and an androgen-dependent second phase. Disruptions in these phases can result in UDT. Factors such as testosterone, follicle-stimulating hormone (FSH), luteinizing hormone (LH), and gene products including insulin like 3 (INSL3), follicle-stimulating hormone receptor (FSHR), luteinizing hormone receptor (LHR), and homeobox A10 (HOXA10) are involved in regulating testicular descent [6-8]. UDT can lead to two major consequences: testicular cancer and/or infertility [9]. Azoospermia, characterized by the absence of sperm due to failed spermatogenesis, may occur in patients with UDT [10].
The Wilms tumor 1 (WT1) gene, located on chromosome 11p13, comprises 10 exons and encodes 24 protein isoforms. These isoforms feature four zinc fingers at the C-terminal region, which function as DNA-binding motifs [11]. An alternative splice donor site at the end of exon 9 results in the presence or absence of three amino acids (lysine [K], threonine [T], and serine [S]), denoted as +KTS/–KTS. These play distinct roles at the protein level. WT1 is crucial for gonadal development, sex determination, and testicular development. The +KTS and –KTS isoforms specifically are involved in splicing and transcription activities, respectively [11,12]. WT1 is highly expressed in Sertoli cells [13] and influences the production of the LHβ subunit of LH through its +KTS or –KTS isoforms [12]. Additionally, WT1 is vital for spermatogenesis, regulating Sertoli cell polarity and steroidogenesis in Leydig cells. Deletion of WT1 results in the downregulation of steroidogenic gene expression and testosterone deficiency [13].
Given the varying prevalence of UDT in different populations and the correlation between WT1's functions, UDT, infertility, and hormonal dysfunctions, it is crucial to investigate potential variations in WT1 among Iranian men with UDT and hypergonadotropic hypogonadism (elevated FSH and LH levels, decreased testosterone levels) who experience azoospermia. Previous studies have identified variations in the second exon of the WT1 gene in patients with UDT [14]. Furthermore, considering the importance of the +KTS/–KTS region in exon 9, our research focuses on analyzing exons 2 and 9 of the WT1 gene to explore potential variations [15].

Methods

1. Study design and sample collection

This case-control study involved 60 non-obstructive azoospermic infertile men with isolated UDT and no gonadal dysgenesis, who were referred to the Royan Institute's infertility clinic between 2014 and 2019. The study was approved by the Ethical Review Board of the Royan Institute, following the principles outlined in the Helsinki Declaration (reference number: IR.ACECR.ROYAN.REC.1395.106). Blood samples were collected after obtaining informed written consent from all patients enrolled. The age of the participants ranged from 25 to 50 years at the time of referral. Seminal sample analysis was conducted after 3–5 days of sexual abstinence. Sperm concentration, motility, and morphology were assessed using the Sperm Class Analyzer system ver. 6.2.0.1 (Microptic Co.) following the World Health Organization (WHO) 2010 guidelines. The normal hormone ranges, as defined by the WHO, are 1.5–12.0 mlU/mL for FSH, 1–10 mlU/mL for LH, and 2–8 ng/mL for testosterone [16]. There is no definitive testosterone level below which a man can be conclusively diagnosed as hypogonadal. The Endocrine Society identifies 3 ng/mL (10.4 nmol/L) as a reasonable lower limit for normal total testosterone levels. The American Association of Clinical Endocrinologists recommends a threshold of 2 ng/mL [17]. Additionally, the International Society of Andrology, International Society for the Study of Ageing Male, European Association of Urology, European Academy of Andrology, and American Society of Andrology suggest that levels below 2.30 ng/mL typically indicate that patients might benefit from testosterone replacement therapy [18]. Therefore, an early morning total serum testosterone level below 3 ng/mL is a clear indicator of hypogonadism, while a level above 4 ng/mL in a healthy adult male patient generally rules out testosterone deficiency.
Hormonal levels in patients were measured using a competitive enzyme-linked immunosorbent assay (ELISA) kit following the method described by Zangeneh et al. [19]. The inclusion criteria for the case group included isolated UDT, azoospermia, and normal karyotypes. Additionally, these patients exhibited several characteristics of hypergonadotropic hypogonadism, including elevated gonadotrophin hormone levels (FSH and LH), reduced testosterone levels, small testicular size, loss of facial hair, and decreased or absent libido. Normal adult testes are ovoid and measure approximately 3 cm (anterior-posterior)×2–4 cm (transverse)×3–5 cm (length), with a volume of 12.5–19 mL [16].
The exclusion criteria included microdeletions of the azoospermia factor (AZF) region, abnormal karyotypes [20], Wilms tumor, kidney diseases, and hypospadias. Cytogenetic analysis and AZF microdeletion detection were conducted using standard methods [21]. Additionally, all patients were screened for any history of genital tract infections known to cause male infertility, such as chlamydia, mycoplasma, and mumps. Those with a prior history of these infections were excluded from the study. Following these criteria, 60 men with non-obstructive azoospermia remained eligible for the study. They were categorized into groups with unilateral and bilateral UDT. The control group comprised 60 fertile men, each with at least one live-born child and no history of infertility or abortion. This group sought services at the Royan Institute for family balancing and sex selection. The ages of men in the control group ranged from 32 to 46 years old.

2. WT1 genotype analysis

Total genomic DNA was extracted from 3 mL of whole blood using the salting-out method. For cell lysis, we utilized various buffers including red blood cell lysis buffer, cell lysis buffer, sodium dodecyl sulfate, and protein precipitation solutions. Additionally, RNase-A enzyme was added to eliminate any RNA present during the process. Subsequently, DNA precipitation was achieved by adding isopropanol and performing a wash with 70% ethanol. Finally, the DNA was solubilized and stored in Tris-ethylenediaminetetraacetic acid (EDTA) buffer. The DNA concentration was then measured using a Nanodrop Spectrophotometer 2000 (Thermo Fisher Scientific). The sequence of the WT1 gene was retrieved from the gene database available at https://www.ncbi.nlm.nih.gov/gene/7490. WT1 primers were designed using Perlprimer ver. 1.1.21 software (https://perlprimer.sourceforge.net) to amplify exons 2 and 9 of WT1 (Table 1). Polymerase chain reaction (PCR) was conducted using 50 ng of total DNA in a final volume of 25 μL, which included 10 μL of PCR Master Mix (Ampliqon) and 5 µM of each primer. PCR was performed on an Eppendorf PCR system with the following parameters: an initial denaturation at 94 °C for 4 minutes, followed by 30 cycles of denaturation at 94 °C for 30 seconds, annealing at 60 °C for 30 seconds, extension at 72 °C for 45 seconds, and a final extension at 72 °C for 8 minutes. After amplification, the PCR products were analyzed by electrophoresis on a 1.2% agarose gel and stained with GelRed (Biotium).

3. Sequencing

PCR products from gene amplifications were sent to Fazabiotech Company for DNA Sanger sequencing. The sequencing followed the Sanger method, utilizing an ABI 3730XL Capillary Sequencer (Applied Biosystems). The results were then compared with the normal sequence of the WT1 gene, using NC_000011.10 as the reference sequence from the National Center for Biotechnology Information (NCBI)-Gene database. Data analysis was conducted using Align Sequences Nucleotide Blast on the NCBI Blast server and Finch TV software ver. 1.4.0 (Geospiza Inc.).

4. Statistical analysis

In this study, the clinical characteristic data are presented as mean±standard deviation. Following the sequencing results, the data were processed and analyzed using SPSS software ver. 20 (IBM Corp.). The chi-square test was employed to analyze the genetic variables in the studied groups, with a significance threshold set at p<0.05.

Results

1. Hormonal profile and type of UDT in patients

Twenty-seven UDT cases were unilateral and 33 cases were bilateral during childhood. Most underwent orchiopexy surgery in the early years of their lives; however, the consequence of infertility became evident later in adulthood. Gonadotropin hormones (FSH, LH) and testosterone levels were evaluated in both the patient and control groups. The average hormone levels in patients and controls were assessed against the normal range, revealing characteristics of hypergonadotropic hypogonadism in the patients. Specifically, FSH and LH levels were significantly elevated in patients with infertile UDT, while testosterone levels were markedly lower than in the control subjects (Table 2).

2. WT1 variants in exon 2

Sequence analysis of the intronic boundaries of the second exon of the WT1 gene revealed a heterozygous intronic variation, rs34924443, in 34 patients (Table 3, Figure 1). This variation involves the insertion and/or deletion of G nucleotide(s) at position NC_000011.10:g.324287061. Although previously reported in the Single Nucleotide Polymorphism Database (dbSNP), this variation has not been documented in the Iranian population. It was also identified in 30 men within the control group. A comparison between the case and control groups showed no significant differences associated with this variation (p=0.4646). No specific transcription factors' binding sites were identified in this region. Additionally, while not reported in ClinVar (National Institutes of Health), this variant is listed as a common variant in the gnomAD browser database v3.1.2. Given its high population frequency, with an allele count of 36441 in 151034 (allele frequency: 0.2413), rs34924443 is classified as benign. Among these alleles, 3271 are from homozygous males from diverse ethnic backgrounds, including European, Ashkenazi Jewish, Latino, South Asian, African, East Asian, and other unspecified ethnicities. The age range of these individuals varies widely, from under 30 to over 80 years, and their parental status is not noted. Based on its high population frequency, rs34924443 is unlikely to contribute to male infertility and is considered a benign variant. Additionally, another intronic variant, rs573747031 (NC_000011.10: g.32428704G>T; NM_000378.6 (WT1): c.662-85C>T), was detected in the heterozygous form in one patient (Table 3, Figure 1). This variant is not listed in ClinVar. According to the gnomAD browser database v3.1.2, it has an allele count of 358 in 152138 (allele frequency: 0.002) and no instances of homozygous males have been reported. Despite its low allele frequency, in silico tools predict no impact on splicing or transcription factors' binding sites. Therefore, it is classified as likely benign according to the recommendation of the American College of Medical Genetics and Genomics (ACMG) and the Association for Molecular Pathology (AMP) guideline.

3. WT1 variants in exon 9

After sequencing of exon 9, a heterozygous nucleotide variation, rs1851834762, was identified at the intronic boundary of this exon in a single infertile patient with UDT (Table 3, Figure 1). This novel intronic variation has not been observed in the Iranian population previously, nor was it detected in any individuals from the control group. Additionally, it has not been reported in ClinVar or gnomAD databases. This variation can be classified as likely benign since it does not affect splicing or transcription, and therefore has no impact on protein expression levels.
In addition, an exonic silent variant, rs374799820 (NC_000011.10: g.32392015G>A; NM_000378.6 [WT1]: c.1353C>T; NP_000369.4: p. Ser469=), was identified in the heterozygous state in an infertile patient with UDT (Table 3, Figure 1). This variant is listed in ClinVar (variation ID: 414085) and has been classified as likely benign according to ACMG/AMP guidelines.
A haplotype consisting of two heterozygous C>T variations was identified in the intronic region at the splice donor site of exon 9 in 11 patients from the case group, which included six with unilateral and five with bilateral UDT. These variations were absent in the control group. Statistical analysis revealed a significant difference between the case and control groups (p=0.022). One of these variations is already documented in dbSNP as rs587776576 (NC_000011.10: g.32391967C>T; NM_000378.4: c.1372+14G>A) and is depicted in Table 3, Figure 1. This variant, located at the splice donor site of +KTS/–KTS, is predicted to adversely affect a known splice site. Functional studies have confirmed its damaging impact and aberrant splicing, which disrupts the ratio of WT1 isoforms [22-25]. It is not present in the total gnomAD v3.1.2 dataset. ClinVar reports this variant (variation ID: 3493) and classifies it as pathogenic according to the ACMG/AMP guideline. Additionally, the allelic frequency of these alterations was found to be 9.16% in this study. Although the other novel intronic single nucleotide variation (NC_000011.10: g.32391969C>T; NM_000378.4: c.1372+12G>A), shown in Figure 1, appears to have no impact on transcription, splicing, or protein expression levels, it has not been observed in ClinVar or gnomAD. However, since it occurs as a haplotype with the known pathogenic variant rs587776576 and has a high calculated odds ratio of 28.11, its role in the pathogenicity of UDT or infertility in the Iranian population remains unclear.

Discussion

Infertility is a widespread issue affecting millions of individuals of reproductive age across the globe. The WT1 gene plays a crucial role in urogenital development, steroidogenesis, spermatogenesis, and hormonal synthesis [26], and has been linked to UDT and impaired sperm cell differentiation in mice [27]. Research involving mice deficient in WT1 has revealed germ cell apoptosis, which mirrors non-obstructive azoospermia in humans [28]. Additionally, variations in WT1 have been found in populations with sexual development disorders and UDT [29]. In a 2011 study, WT1 gene analysis was conducted on 210 patients with a history of hypospadias, UDT, and/or nephropathy during childhood or adolescence. Of these, six patients showed WT1 variations and presented with both hypospadias and at least one-sided UDT. Interestingly, patients with only hypospadias showed no WT1 variations [29]. Furthermore, WT1 is involved in the steroidogenesis process in Leydig cells, increasing the efficiency of testosterone production [13]. Previous research has shown that the WT1 gene is critical in LHβ transcription, influenced by its two significant isoforms, +KTS and –KTS. Here, WT1 (+KTS) functions as a suppressor, while WT1 (-KTS) serves as an enhancer of LHβ transcription, which is stimulated by gonadotropin-releasing hormone [12]. These findings indicate that WT1 gene variations could potentially lead to gonadotropin hormone deficiency by impacting LHβ transcription. Seabra et al. [14] conducted a study on 31 patients with either unilateral or bilateral UDT, focusing on the first six exons of the WT1 gene. They discovered two WT1 missense substitutions in patients with urogenital disorders such as hypospadias or UDT, but not in those with nephropathy. Notably, one variant near the first zinc finger (p. Cys350Arg) was more common in patients with severe oligospermia [14]. This study provides additional evidence of the potential role of WT1 genetic aberrations in UDT.
In light of the role of WT1 in infertility and UDT, we hypothesized that WT1 variations might be present in Iranian patients with isolated UDT who do not have nephropathy or Wilms tumor disease. Our study indeed identified variations in exons two and nine of the WT1 gene, revealing a significant difference in the haplotype of two heterozygous variations of C>T between the case and control groups (p=0.022). One of these variations, rs587776576 (NC_000011.10: g.32391967C>T; NM_000378.4: c.1372+14G>A), has been previously reported in dbSNP. Notably, none of the other phenotypes typically associated with rs587776576, such as Frasier syndrome, multiple sclerosis, or hereditary nephrotic syndrome, were observed in our patients. This suggests a unique impact of this variation in the Iranian population. The specific impact of the second variant on rs587776576 or its potential to modify the phenotype remains uncertain, warranting further mRNA or protein-level functional analysis, especially since our patients exhibited milder clinical phenotypes compared to those associated with the mentioned syndromes. Unfortunately, the absence of parental samples prevented us from determining the parent of origin or inheritance pattern of the variants.
However, the four variants (rs34924443, rs374799820, rs573747031, and rs1851834762) located in the intronic regions of exons 2 and 9 showed no significant differences between the case and control groups. This suggests that they are not associated with UDT or infertility.
In conclusion, while four variants in the intronic region did not correlate with UDT or infertility, the haplotype of C/T variations in the splice donor site of +KTS/–KTS, particularly rs587776576, demonstrated a significant association with infertility and UDT in the Iranian population. Further functional analysis and investigations involving a larger sample size are required to enhance our understanding of the impact of these gene variants on isolated UDT and infertility.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

We extend our gratitude to the participants of the study and to the staff of the Genetic Laboratory at the Royan Institute for their technical assistance and services.

Author contributions

Conceptualization: NS, PBB, KH, MS, AMM. Methodology: MS, AMM. Formal analysis: PBB, MS, AMM. Data curation: NS, PBB, KH. Funding acquisition: MS, AMM. Project administration: NS, PBB. Visualization: NS, PBB, KH, MS, AMM. Software: NS, AMM. Validation: NS, PBB, MS, AMM. Investigation: NS, PBB, KH, MS, AMM. Writing-original draft: NS, PBB, KH, AMM. Writing-review & editing: PBB, MS, AMM. Approval of final manuscript: NS, PBB, KH, MS, AMM.

Figure 1.
Direct sequencing of the polymerase chain reaction (PCR) products of exon two and nine regions of Wilms tumor 1 (WT1) gene. (A) Normal form of the intronic poly C region of exon two. (B) Intronic heterozygous variation rs34924443, insertion of the G nucleotide(s). (C) Intronic heterozygous variation rs34924443, deletion of the G nucleotide(s). (D) Intronic heterozygous variation rs1851834762 of exon nine. (E) Exonic heterozygous variation rs374799820 of exon nine (Image from reverse strand). (F) Two haplotype alternate heterozygous C>T intronic variations of exon nine, the second one as rs587776576 (Image from reverse strand). (G) Intronic heterozygous variation rs573747031G>T.
cerm-2024-07584f1.jpg
Table 1.
Oligonucleotide sequences and characteristics of the WT1 gene
Primers name Locus Sequence Size (bp) GC (%)
WT1 exon 2 forward Int1+Ex2 TGTCCCAAGGTCACATCCAG 422 59.31
WT1 exon 2 reverse Ex2+Int2 GTCCTCCTTTGCCTAATTTGCT 422 58.91
WT1 exon 9 forward Int8+Ex9 GGAAATCTAAGGGTGAGGCAG 385 58.08
WT1 exon 9 reverse Ex9+Int10 TTAAAGATAGCCACGCACTATTCC 385 58.95

WT1, Wilms tumor 1; Int, intron; Ex, exon.

Table 2.
Hormonal features of undescended testis patients and controls
Hormone Mean±SD Mean±SD of controls Normal range
FSH (mIU/mL) 36.32±20.04 7.75±4.50 1.5–12.0
LH (mIU/mL) 16.83±6.62 5.32±2.87 1–10
Testosterone (ng/mL) 1.19±1.02 4.58±2.21 3–8

SD, standard deviation; FSH, follicle-stimulating hormone; LH, luteinizing hormone.

Table 3.
Statistical analysis of observed variations between the case and control groups
Variation Location Groups Odds ratio Significance p-value Zygosity (patients) Zygosity (controls) Allelic frequency (%)
Case (n=60) Control (n=60) Case (n=60) Control (n=60)
rs34924443 Intron 1 34 30 1.3077 0.4646 Heterozygous (n=28) Heterozygous (n=26) 33.33 28.33
Homozygous (n=6) Homozygous (n=8)
rs573747031 Intron 1 1 0 3.0504 0.4973 Heterozygous (n=1) 0 0.83 0
rs1851834762 Intron 8 1 0 3.0504 0.4973 Heterozygous (n=1) 0 0.83 0
rs374799820 Exon 9 1 0 3.0504 0.4973 Heterozygous (n=1) 0 0.83 0
rs587776576 Intron 8 (splice donor site) 11 0 28.1111 0.0221 Heterozygous (n=11) 0 9.16 0

The statistical analysis was performed using the chi-square method (p<0.05).

References

1. Olesen IA, Andersson AM, Aksglaede L, Skakkebaek NE, Rajpert-de Meyts E, Joergensen N, et al. Clinical, genetic, biochemical, and testicular biopsy findings among 1,213 men evaluated for infertility. Fertil Steril 2017;107:74-82.
crossref pmid
2. Punab M, Poolamets O, Paju P, Vihljajev V, Pomm K, Ladva R, et al. Causes of male infertility: a 9-year prospective monocentre study on 1737 patients with reduced total sperm counts. Hum Reprod 2017;32:18-31.
crossref pmid pmc
3. Agarwal A, Mulgund A, Hamada A, Chyatte MR. A unique view on male infertility around the globe. Reprod Biol Endocrinol 2015;13:37.
crossref pmid pmc pdf
4. Poongothai J, Gopenath TS, Manonayaki S. Genetics of human male infertility. Singapore Med J 2009;50:336-47.
pmid
5. Kaleva M, Toppari J. Cryptorchidism: an indicator of testicular dysgenesis? Cell Tissue Res 2005;322:167-72.
crossref pmid pdf
6. Barthold JS, Reinhardt S, Thorup J. Genetic, maternal, and environmental risk factors for cryptorchidism: an update. Eur J Pediatr Surg 2016;26:399-408.
crossref pmid
7. Germiyanoglu C, Huri E, Ersoy E. Re: the incidence of disorders of sexual differentiation and chromosomal abnormalities of cryptorchidism and hypospadias stratified by meatal location. M. J. Cox, D. E. Coplen and P. F. Austin. J Urol 2008; 180: 2649-2652. J Urol 2009;182:398.
crossref pmid
8. Snodgrass W, Bush N, Holzer M, Zhang S. Current referral patterns and means to improve accuracy in diagnosis of undescended testis. Pediatrics 2011;127:e382-8.
crossref pmid pmc pdf
9. Komarowska MD, Hermanowicz A, Debek W. Putting the pieces together: cryptorchidism: do we know everything? J Pediatr Endocrinol Metab 2015;28:1247-56.
crossref pmid
10. Gudeloglu A, Parekattil SJ. Update in the evaluation of the azoospermic male. Clinics (Sao Paulo) 2013;68 Suppl 1:27-34.
crossref pmid pmc
11. Kohler B, Delezoide AL, Boizet-Bonhoure B, McPhaul MJ, Sultan C, Lumbroso S. Coexpression of Wilms’ tumor suppressor 1 (WT1) and androgen receptor (AR) in the genital tract of human male embryos and regulation of AR promoter activity by WT1. J Mol Endocrinol 2007;38:547-54.
crossref pmid
12. Bagchi D, Andrade J, Shupnik MA. A new role for Wilms tumor protein 1: differential activities of + KTS and -KTS variants to regulate LHβ transcription. PLoS One 2015;10:e0116825.
crossref pmid pmc
13. Chen M, Wang X, Wang Y, Zhang L, Xu B, Lv L, et al. Wt1 is involved in Leydig cell steroid hormone biosynthesis by regulating paracrine factor expression in mice. Biol Reprod 2014;90:71.
crossref pmid
14. Seabra CM, Quental S, Lima AC, Carvalho F, Goncalves J, Fernandes S, et al. The mutational spectrum of WT1 in male infertility. J Urol 2015;193:1709-15.
crossref pmid
15. Mazen I, Hassan H, Kamel A, Mekkawy M, McElreavey K, Essawi M. WT1 gene mutation, p.R462W, in a 46,XY DSD patient from Egypt with gonadoblastoma and review of the literature. Sex Dev 2017;11:280-3.
crossref pmid pdf
16. World Health Organization. The influence of varicocele on parameters of fertility in a large group of men presenting to infertility clinics. Fertil Steril 1992;57:1289-93.
crossref pmid
17. Dandona P, Rosenberg MT. A practical guide to male hypogonadism in the primary care setting. Int J Clin Pract 2010;64:682-96.
crossref pmid pmc
18. Wang C, Nieschlag E, Swerdloff R, Behre HM, Hellstrom WJ, Gooren LJ, et al. Investigation, treatment and monitoring of late-onset hypogonadism in males: ISA, ISSAM, EAU, EAA and ASA recommendations. Eur J Endocrinol 2008;159:507-14.
pmid pmc
19. Zangeneh F, Salman Yazdi R, Naghizadeh MM, Abedinia N. Effect of Ramadan fasting on stress neurohormones in women with polycystic ovary syndrome. J Family Reprod Health 2015;9:51-7.
pmid pmc
20. Sharifi N, Sabbaghian M, Farrahi F, Almadani N, Boroujeni PB, Meybodi AM. Cytogenetic assessment of Iranian infertile men with undescended testis: a retrospective study. JBRA Assist Reprod 2020;24:400-4.
crossref pmid pmc
21. Totonchi M, Mohseni Meybodi A, Borjian Boroujeni P, Sedighi Gilani M, Almadani N, Gourabi H. Clinical data for 185 infertile Iranian men with Y-chromosome microdeletion. J Assist Reprod Genet 2012;29:847-53.
crossref pmid pmc pdf
22. Lehnhardt A, Karnatz C, Ahlenstiel-Grunow T, Benz K, Benz MR, Budde K, et al. Clinical and molecular characterization of patients with heterozygous mutations in Wilms tumor suppressor gene 1. Clin J Am Soc Nephrol 2015;10:825-31.
crossref pmid pmc
23. Li J, Ding J, Zhao D, Yu Z, Fan Q, Chen Y, et al. WT1 gene mutations in Chinese children with early onset nephrotic syndrome. Pediatr Res 2010;68:155-8.
crossref pmid
24. Lipska BS, Iatropoulos P, Maranta R, Caridi G, Ozaltin F, Anarat A, et al. Genetic screening in adolescents with steroid-resistant nephrotic syndrome. Kidney Int 2013;84:206-13.
pmid
25. Klamt B, Koziell A, Poulat F, Wieacker P, Scambler P, Berta P, et al. Frasier syndrome is caused by defective alternative splicing of WT1 leading to an altered ratio of WT1 +/-KTS splice isoforms. Hum Mol Genet 1998;7:709-14.
crossref pmid
26. Kohler B, Schumacher V, l’Allemand D, Royer-Pokora B, Gruters A. Germline Wilms tumor suppressor gene (WT1) mutation leading to isolated genital malformation without Wilms tumor or nephropathy. J Pediatr 2001;138:421-4.
crossref pmid
27. Kaftanovskaya EM, Neukirchner G, Huff V, Agoulnik AI. Left-sided cryptorchidism in mice with Wilms’ tumour 1 gene deletion in gubernaculumtestis. J Pathol 2013;230:39-47.
crossref pmid pmc pdf
28. Wang XN, Li ZS, Ren Y, Jiang T, Wang YQ, Chen M, et al. The Wilms tumor gene, Wt1, is critical for mouse spermatogenesis via regulation of sertoli cell polarity and is associated with non-obstructive azoospermia in humans. PLoS Genet 2013;9:e1003645.
crossref pmid pmc
29. Kohler B, Biebermann H, Friedsam V, Gellermann J, Maier RF, Pohl M, et al. Analysis of the Wilms’ tumor suppressor gene (WT1) in patients 46,XY disorders of sex development. J Clin Endocrinol Metab 2011;96:E1131-6.
crossref pmid pdf
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 1 Web of Science
  • 1 Crossref
  • 1 Scopus
  • 3,740 View
  • 54 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next