Impact of third cleavage timing on blastulation and miRNA-429 expression in cryopreserved mouse embryos

Article information

Korean J Fertil Steril. 2026;.cerm.2025.07997
Publication date (electronic) : 2026 January 14
doi : https://doi.org/10.5653/cerm.2025.07997
1Suji Maria Fertility Center, Yongin, Korea
2Research Institute for Pharmaceutical Sciences, College of Pharmacy, Seoul National University, Seoul, Korea
3Department of Senior Healthcare, Graduate School of Eulji University, Seongnam, Korea
4Department of Biomedical Laboratory Science, Eulji University, Seongnam, Korea
5Eulji Medi-Bio Research Institute (EMBRI), Eulji University, Daejeon, Korea
Corresponding author: Jaewang Lee Department of Biomedical Laboratory Science, Eulji University, 553 Sanseong-daero, Sujeong-gu, Seongnam 13135, Korea Tel: +82-31-740-7144 Fax: +82-31-740-7144 E-mail: wangjaes@gmail.com
Co-corresponding author: Jin Hyun Jun Department of Biomedical Laboratory Science, Eulji University, 553 Sanseong-daero, Sujeong-gu, Seongnam 13135, Korea Tel: +82-31-740-7210 Fax: +82-31-740-7211 E-mail: junjh55@hanmail.net
*These authors contributed equally to this study.
Received 2025 March 28; Revised 2025 May 7; Accepted 2025 May 9.

Abstract

Objective

The aims of this study were to assess embryonic development using a time-lapse monitoring system based on cleavage timing and the use of vitrification and to investigate the correlation between miRNA-429 expression and embryonic development in both fresh and vitrified-thawed embryos.

Methods

Mouse embryos at the 1-cell stage were collected and randomly divided into fresh and vitrified-thawed groups. The embryos were monitored and further subdivided into early and delayed cleavage based on the timing of the third cleavage event at 55 hours after human chorionic gonadotropin injection. miRNA-429 extracted from spent media or embryos cultured in vitro was analyzed by quantitative reverse transcription-polymerase chain reaction.

Results

Early cleavage was associated with a significantly higher blastulation rate, regardless of cryopreservation status. Notably, among vitrified-thawed embryos, outgrowth was greater in those exhibiting early cleavage compared to those with delayed cleavage. Furthermore, miRNA-429 expression was elevated in embryos exhibiting delayed cleavage, but only within the cryopreserved group.

Conclusion

Based on these findings, we suggest that the timing of the third cleavage event may be more critical than the vitrification process itself, and evaluating miRNA-429 expression could serve as an alternative non-invasive selection tool for vitrified surplus embryos.

Introduction

Assessment of embryo quality is a critical step toward achieving successful pregnancy in human in vitro fertilization and embryo transfer programs. Many invasive and non-invasive techniques have been introduced for evaluating embryo quality, including pre-implantation genetic screening, morphological assessment, time-lapse evaluation, and analysis of metabolite or genetic molecule consumption/release in spent blastocyst culture medium (SBM) [1-4]. Among these techniques, the timing of the third cleavage event as monitored by time-lapse evaluations has been examined as a potential predictor of embryo development and implantation potential [5,6]. However, morphokinetic assessments alone exhibit certain limitations for selective embryo transfer. Recent studies have proposed analyzing metabolite changes associated with embryonic status and in vitro culture conditions as a novel, non-invasive approach for evaluating embryo quality [7-9].

MicroRNAs (miRNAs) are non-coding RNA molecules typically composed of 20 to 24 nucleotides. They play diverse roles in physiological processes, including homeostasis and cell differentiation, through the degradation or inhibition of target gene expression [10]. Certain miRNAs have been reported to relate to blastocyst activation and attachment, such as the miR-200/429 family [11,12]. Members of this family have been detected in uterine luminal fluid and are involved in epithelial-mesenchymal transition (EMT), decidualization, and implantation [13-17]. Moreover, significantly lower miRNA-429 expression has been found in the endometria of patients with repeated implantation failure [16].

Vitrification is an efficient and safe method for preserving surplus gametes and zygotes for future use. However, the cryopreservation process may result in a loss of cell viability and function. Additionally, vitrification can alter the epigenetic state, including changes in miRNA expression and methylation patterns [18,19]. Few studies have investigated the implantation and survival rates of vitrified embryos to evaluate the safety and efficiency of this procedure [18,19].

In the present study, we investigated (1) the association between the timing of the third cleavage and embryo development, irrespective of vitrification status; and (2) whether altered miRNA-429 expression could serve as a valuable non-invasive marker for embryo selection after vitrification-thawing.

Methods

1. Superovulation and embryo collection in mice

Our study was approved by the ethics committee at the Eulji University Institutional Animal Care and Use Committee (EUIACUC-17-14). Female Institute of Cancer Research (ICR) mice (aged 6 to 8 weeks) were housed under standard conditions (12-hour light/dark cycle, temperature 22±2 °C, humidity 50%±10%), with free access to food and water. Superovulation was induced by injecting the mice with 5 IU pregnant mare’s serum gonadotropin (Sigma-Aldrich), followed by injection of human chorionic gonadotropin (hCG; Sigma-Aldrich) 46 hours later. Subsequently, the female mice were mated with sexually mature Institute of Cancer Research (ICR) male mice. The following morning, female mice exhibiting vaginal plugs were sacrificed, and pronuclear-stage (PN) zygotes were obtained 0.5 days post coitum. Cumulus-oocyte complexes were collected by tearing the ampulla using a 26-gauge needle. Cumulus cells were removed by incubating the zygotes in 85 IU/mL hyaluronidase (Sigma-Aldrich). The zygotes were then transferred into collection medium.

2. Vitrification and thawing of embryos

Three hours after collection, denuded PN embryos were randomly assigned to fresh (F) and vitrification (V) groups. The vitrification procedure was performed using an equilibration solution (ES) consisting of 7.5% ethylene glycol (EG; Sigma-Aldrich) and 7.5% dimethyl sulfoxide (DMSO; Sigma-Aldrich) in Dulbecco phosphate-buffered saline (DPBS; Gibco) supplemented with 10% serum protein substitute (SPS; SAGE/Origio). The vitrification solution (VS) contained 15% EG and 15% DMSO, as previously described [20]. For warming, a washing solution (WS) consisting of 10% SPS in DPBS was used. During vitrification, PN embryos were equilibrated in ES for 7 minutes. Subsequently, groups of five to six embryos were loaded onto a Cryotop device (Kitazato), transferred into VS for 30 seconds to 1 minute, and immediately plunged into liquid nitrogen (LN2) within 1 minute. After storage in LN2 for 2 hours, the embryos underwent the warming process. Briefly, embryos were incubated in 1 M sucrose solution for 1 minute, followed by 0.5 M sucrose solution for 3 minutes, and then placed in WS for 5 minutes. Finally, embryos were transferred into Quinn’s Advantage cleavage medium (SAGE) for culture.

3. Grouping of embryos by the timing of the third cleavage

Embryos were further subdivided into two groups based on the timing of the third cleavage event at 55 hours post-hCG injection: early cleavage (EC) and delayed cleavage (DC), according to the criteria described by Kim et al. [5]. Groups of five embryos were cultured in a 15 µL drop of Quinn’s Advantage blastocyst medium (SAGE) until reaching the blastocyst stage (127 hours post-hCG injection). After in vitro culture, blastocysts and SBM were collected for analysis of miRNA-429 expression, as illustrated in Figure 1.

Figure 1.

Experimental scheme of the study. One-cell embryos were collected at 22 hours after injection of human chorionic gonadotropin (hCG). Collected embryos were randomly divided into fresh (F) and vitrified-thawed (V) groups. Each group was further subdivided into early cleavage (EC) and delayed cleavage (DC) based on the timing of the third cleavage at 55 hours post-hCG injection. For miRNA analysis, 6 µL of spent blastocyst medium and in vitro-cultured blastocysts were retrieved 127 hours post-hCG injection. After the blastocysts hatched, embryos were cultured for an additional 72 hours to assess developmental competence in vitro. PMSG, pregnant mare’s serum gonadotropin; SBM, spent blastocyst culture medium; dpc, days post coitum.

4. Nuclear staining of embryos cultured in vitro

Morulae and blastocysts obtained from the F-EC, F-DC, V-EC, and V-DC groups were fixed with 4% paraformaldehyde (Biosesang) at 103 and 127 hours post-hCG injection, respectively, as shown in Figure 1. Embryos were then washed three times in DPBS containing 0.1% polyvinylpyrrolidone (Sigma-Aldrich). Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI; Vector Laboratories) for 10 minutes and observed using a fluorescence microscope (Olympus). The nuclei of embryos were counted from images captured by fluorescence microscopy to evaluate embryo developmental competence.

5. Quantitative reverse transcription-polymerase chain reaction for miRNAs in SBM and blastocysts

miRNAs were isolated from blastocysts in each group using the mirVana miRNA kit (Ambion). SBM was prepared directly for quantitative reverse transcription-polymerase chain reaction (qRT-PCR) without any additional isolation or treatment steps. Complementary DNA (cDNA) was synthesized using the TaqMan reverse transcription kit (Applied Biosystems) with a final volume of 15 μL. For quantitative analysis, quantitative PCR was performed with a total reaction volume of 20 μL, containing 1 pmol of each TaqMan probe (Applied Biosystems) and 2 μL of diluted cDNA (equivalent to 0.4 blastocyst), using the StepOne system (Applied Biosystems). The reaction conditions were as follows: enzyme activation at 95 °C for 10 minutes, followed by 45 cycles of denaturation at 95 °C for 15 seconds and annealing at 60 °C for 1 minute. The sequences for the TaqMan probes used in this study are listed in Table 1. Quantitative analysis of miRNAs was performed using the 2−ΔΔCt method with let-7b as an internal control.

Mature microRNA-429 sequences of TaqMan probes used for qRT-PCR

6. Outgrowth assay for evaluating the implantation potential in vitro

Blastocysts cultured up to 127 hours post-hCG injection were transferred into drops of media composed of Dulbecco modified Eagle medium (Gibco) supplemented with 10% fetal bovine serum (Gibco). These blastocysts were cultured further to allow outgrowth (OG) up to 199 hours after hCG injection. To evaluate peri-implantation developmental competence, the areas of OG embryos were measured using ImageJ (National Institutes of Health), as previously described [21].

Measurements of the trophectoderm (TE) and inner cell mass (ICM) areas in OG embryos were expressed as mean±standard error of the mean (SEM). The quality of OG embryos was scored based on established morphological criteria [22,23].

ICM grades (1 to 3) were assigned as follows:

• Grade 1: indistinguishable or no visible ICM development;

• Grade 2: small area of ICM development or loosely arranged;

• Grade 3: large and compact ICM.

TE grades (1 to 3) were assigned as follows:

• Grade 1: no or very few TE cells spreading;

• Grade 2: small area of spreading TE cells;

• Grade 3: large area of spreading TE cells.

7. Statistical analysis

All experiments were conducted in triplicate or more. Data are presented as mean±SEM. Statistical differences between groups were analyzed using the chi-square and Student t-test. A p-value of less than 0.05 was considered to indicate statistical significance.

Results

1. Embryo development and cell numbers of developing embryos

Figure 2 shows embryo development after 127 hours of culture in vitro. A total of 445 embryos were cultured to compare developmental potential across groups. The survival and cleavage rates were similar among all groups (F-EC: 98.9%, F-DC: 90.1%, V-EC: 98.2%, V-DC: 85.1%; p>0.05). However, the proportion of morula formation was significantly higher in EC embryos compared to DC embryos in both fresh (F-EC: 99.3% vs. F-DC: 92.9%, p<0.05) and vitrified-thawed (V-EC: 99.1% vs. V-DC: 82.3%, p<0.001) groups, as illustrated in Figure 3A. In blastocyst development, DC markedly reduced developmental potential in both fresh and vitrified-thawed embryos. Blastulation was significantly higher in the F-EC and V-EC groups compared to their respective DC counterparts (F-EC: 95.4% vs. F-DC: 66.9%, p<0.001; V-EC: 89.7% vs. V-DC: 56.3%, p<0.001) (Figure 3B). Regarding blastomere numbers per embryo at the morula stage, the F-EC group exhibited a higher number than the other three groups (F-EC: 38.9±4.4, F-DC: 24.5±1.8, V-EC: 23.0±1.9, V-DC: 15.1±1.2, p<0.001) (Figure 3C). However, these significant differences in blastomere number disappeared by the blastocyst stage (Figure 3D).

Figure 2.

Morphology of cultured mouse pre-implantation embryos. Five embryos per group were cultured from the pronuclear-stage to the blastocyst stage in single drops (10 µL) of medium. Culture conditions were maintained across all experimental groups. Representative embryo morphologies are shown at 55 hours post-human chorionic gonadotropin (hCG) injection (1.5 days post coitum [dpc]; A, B, C, D), 79 hours (2.5 dpc; E, F, G, H), 103 hours (3.5 dpc; I, J, K, L), and 127 hours (4.5 dpc; M, N, O, P). Scale bars indicate 100 μm. F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage.

Figure 3.

Pre-implantation embryo quality based on developmental stage and blastomere count. Embryo development, from the pronuclear-stage to the morula (A) and blastocyst (B) stages, was compared among groups. Blastomere numbers in morulae (C) and blastocysts (D) after in vitro culture are also presented. Different letters indicate statistically significant differences (p<0.05). F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage. a),b),c)Different letters indicate statistically different (p<0.05).

2. Morphological analysis of TE and ICM in OG embryos

As mentioned previously, embryos were subdivided based on the timing of the third cleavage event during embryogenesis (EC vs. DC). An in vitro OG assay was conducted to assess implantation potential (Figure 4A). Regarding the OG rates, DC and the cryopreservation process markedly reduced implantation potential (Figure 4B). Nevertheless, other morphological assessment criteria, including mean areas and scores for ICM and TE, were comparable across the four groups (Figure 4C-4F).

Figure 4.

Evaluation of peri-implantation embryos using an outgrowth assay. After hatching, blastocysts were cultured further to assess their outgrowth ability. At 72 hours after in vitro culture, hatched blastocysts were attached to the culture plate (A-a), and trophectoderm (TE, A-b) and inner cell mass (ICM, A-c) were distinguishable. Scale bar indicates 100 μm. Only the timing of the third cleavage was significantly associated with the proportion of outgrowth embryos at 199 hours post-human chorionic gonadotropin (hCG) injection (B). Mean areas and scores for ICM (C, D) and TE (E, F) were comparable across groups. Different letters indicate significant differences (p<0.05). F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage. a),b)Different letters indicate statistically different (p<0.05).

3. Expression of miRNA-429 in SBM and blastocysts

In this study, we selected miRNA-429 as a non-invasive biomarker to evaluate correlations between embryo development and third cleavage timing, with and without vitrification. Although the timing of third cleavage alone did not affect miRNA-429 expression in blastocysts, vitrification significantly accelerated miRNA-429 upregulation, as shown in Figure 5A, 5B (p<0.05). This phenomenon was also observed in conditioned medium collected from embryo culture (Figure 5C, 5D). Interestingly, miRNA-429 levels from both conditioned media and blastocysts in the V-DC group were significantly higher than those in the V-EC group.

Figure 5.

miRNA-429 expression in spent embryo culture medium (SECM) and blastocysts derived under different culture conditions. Cryopreservation status influenced miRNA-429 expression, which has a putative role in implantation. In the fresh groups, miRNA-429 expression was comparable between EC and DC embryos in both SECM and blastocyst samples (A and C). However, miRNA-429 expression in SECM and blastocysts from DC embryos following cryopreservation was significantly higher than that in EC embryos after vitrification and warming (B and D). F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage.

Discussion

Several studies have reported that the third cleavage event in pre-implantation embryos serves as a morphokinetic predictor for elective embryo transfer [24-27]. Similarly, our findings demonstrated that early-cleaving embryos exhibited higher proportions of morula and blastocyst formation compared to delayed-cleaving embryos, regardless of vitrification status (Figure 3). When delayed third cleavage was combined with vitrification, embryo outgrowth was significantly reduced compared to early-cleaving embryos in both fresh and vitrified-thawed groups. This aligns with previous studies indicating that early-cleaving embryos possess greater developmental competence than delayed-cleaving embryos [5,6].

Although embryologists still primarily rely on morphological assessments to select embryos for transfer, embryo quality can also be evaluated by analyzing secreted molecules, including proteins, macromolecules, and miRNAs, during in vitro culture [21]. miRNAs have demonstrated diverse roles in embryo development, implantation, and subsequent developmental stages [10,28-33]. We therefore focused on miRNA-429, which was shown to potentially impact embryo development in our prior research [33]. Notably, in this study, miRNA-429 expression was significantly elevated in embryos that underwent early third cleavage followed by vitrification-warming (Figure 5B, 5D). Importantly, miRNA-429 could also be detected in the conditioned medium collected from embryos, suggesting that miRNA expression analysis may offer a valuable, non-invasive approach for selecting embryos for elective transfer.

In this study, we assessed miRNA-429 expression as a marker of embryo quality for implantation. This miRNA belongs to the miR-200 family, which has been extensively studied. Reduced endometrial miRNA-429 expression has been associated with repeated implantation failure [16]. The miR-200 family influences EMT by targeting EMT-inducing factors, such as zinc finger E-box binding homeobox-1 and specificity protein 1 [34-36]. EMT involves substantial phenotypic changes, including altered cell–cell adhesion, loss of cell polarity, and increased migratory and invasive capacities. This process plays a critical role in various physiological and pathological events, such as embryo implantation, embryonic development, cancer progression, invasion, and metastasis. Moreover, embryo-derived miRNAs or microvesicles can mediate communication with maternal tissues during implantation [37]. Many studies have demonstrated that embryos influence immune cell differentiation and regulation, which are critical for successful pregnancy. miRNAs may modulate maternal immune tolerance toward the fetus by affecting uterine immune cells [38]. Previous bioinformatics research has identified associations between implantation failure, miRNA expression, and inflammatory cytokines [39].

We evaluated embryo quality using the timing of the third cleavage event, which has been described as a useful indicator of embryo developmental competence [5,6]. However, no prior studies have explored how the combination of third cleavage timing and vitrification impacts mammalian embryo development. To our knowledge, this study is the first to demonstrate that combined delayed third cleavage and vitrification can reduce developmental potential in mouse embryos, indicating its possible predictive value for embryo implantation success and embryo preservation.

The primary limitation of this study is that we did not directly assess implantation potential via embryo transfer. We chose not to transfer embryos to reduce the number of animals required for the experiments. Additionally, the precise mechanisms underlying how the combination of vitrification and delayed third cleavage decreases embryonic development and implantation potential require further investigation. Another limitation is that we measured only miRNA-429 as a potential biomarker, based on our previous findings [33]. Therefore, we plan to evaluate additional miRNAs as biomarkers for embryo selection in future studies.

Based on these results, monitoring the timing of third cleavage using a time-lapse system and measuring miRNA-429 in conditioned medium via qRT-PCR may represent a safe, efficient strategy for selecting embryos and preserving surplus gametes and zygotes. However, additional studies are necessary to validate these findings and to predict implantation and developmental potential both in vivo and in utero.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Author contributions

Conceptualization: YEL, JK, JL, JHJ. Methodology: YEL. Formal analysis: YEL. Data curation: YEL, JL. Project administration: JHJ. Visualization: YEL, JL. Software: YEL, JL. Validation: JL, JHJ. Investigation: YEL, JL, JHJ. Writing-original draft: YEL, JK, JL, JHJ. Writing-review & editing: YEL, JL, JHJ. Approval of final manuscript: YEL, JK, JL, JHJ.

References

1. Lundin K, Ahlstrom A. Quality control and standardization of embryo morphology scoring and viability markers. Reprod Biomed Online 2015;31:459–71. 10.1016/j.rbmo.2015.06.026. 26277586.
2. de los Santos MJ, Arroyo G, Busquet A, Calderon G, Cuadros J, Hurtado de Mendoza MV, et al. A multicenter prospective study to assess the effect of early cleavage on embryo quality, implantation, and live-birth rate. Fertil Steril 2014;101:981–7. 10.1016/j.fertnstert.2013.12.043. 24502893.
3. Nyalwidhe J, Burch T, Bocca S, Cazares L, Green-Mitchell S, Cooke M, et al. The search for biomarkers of human embryo developmental potential in IVF: a comprehensive proteomic approach. Mol Hum Reprod 2013;19:250–63. 10.1093/molehr/gas063. 23247814.
4. Shamonki MI, Jin H, Haimowitz Z, Liu L. Proof of concept: preimplantation genetic screening without embryo biopsy through analysis of cell-free DNA in spent embryo culture media. Fertil Steril 2016;106:1312–8. 10.1016/j.fertnstert.2016.07.1112. 27565258.
5. Kim J, Kim SH, Jun JH. Prediction of blastocyst development and implantation potential in utero based on the third cleavage and compaction times in mouse pre-implantation embryos. J Reprod Dev 2017;63:117–25. 10.1262/jrd.2016-129. 27980237.
6. Cruz M, Garrido N, Herrero J, Perez-Cano I, Munoz M, Meseguer M. Timing of cell division in human cleavage-stage embryos is linked with blastocyst formation and quality. Reprod Biomed Online 2012;25:371–81. 10.1016/j.rbmo.2012.06.017. 22877944.
7. Daughtry BL, Chavez SL. Time-lapse imaging for the detection of chromosomal abnormalities in primate preimplantation embryos. Methods Mol Biol 2018;1769:293–317. 10.1007/978-1-4939-7780-2_19. 29564832.
8. Magata F, Ideta A, Okubo H, Matsuda F, Urakawa M, Oono Y. Growth potential of bovine embryos presenting abnormal cleavage observed through time lapse cinematography. Theriogenology 2019;133:119–24. 10.1016/j.theriogenology.2019.04.031. 31085381.
9. Sun K, Lun FM, Leung TY, Chiu RW, Lo YM, Sun H. Noninvasive reconstruction of placental methylome from maternal plasma DNA: potential for prenatal testing and monitoring. Prenat Diagn 2018;38:196–203. 10.1002/pd.5214. 29334402.
10. Heidari F, Hosseini S, Yeganeh SM, Salehi M. Expression of miR-Let-7a, miR-15a, miR-16-1, and their target genes in fresh and vitrified embryos and its surrounding culture media for noninvasive embryo assessment. J Cell Biochem 2019;120:19691–8. 10.1002/jcb.29275. 31297859.
11. Liu W, Niu Z, Li Q, Pang RT, Chiu PC, Yeung WS. MicroRNA and embryo implantation. Am J Reprod Immunol 2016;75:263–71. 10.1111/aji.12470. 26707514.
12. Liu WM, Pang RT, Cheong AW, Ng EH, Lao K, Lee KF, et al. Involvement of microRNA lethal-7a in the regulation of embryo implantation in mice. PLoS One 2012;7e37039. 10.1371/journal.pone.0037039. 22623977.
13. Estella C, Herrer I, Moreno-Moya JM, Quinonero A, Martinez S, Pellicer A, et al. miRNA signature and Dicer requirement during human endometrial stromal decidualization in vitro. PLoS One 2012;7e41080. 10.1371/journal.pone.0041080. 22911744.
14. Jimenez PT, Mainigi MA, Word RA, Kraus WL, Mendelson CR. miR-200 regulates endometrial development during early pregnancy. Mol Endocrinol 2016;30:977–87. 10.1210/me.2016-1050. 27533790.
15. Li Z, Gou J, Jia J, Zhao X. MicroRNA-429 functions as a regulator of epithelial-mesenchymal transition by targeting Pcdh8 during murine embryo implantation. Hum Reprod 2015;30:507–18. 10.1093/humrep/dev001. 25609238.
16. Shi C, Shen H, Fan LJ, Guan J, Zheng XB, Chen X, et al. Endometrial microRNA signature during the window of implantation changed in patients with repeated implantation failure. Chin Med J (Engl) 2017;130:566–73. 10.4103/0366-6999.200550. 28229988.
17. Zheng Q, Zhang D, Yang YU, Cui X, Sun J, Liang C, et al. MicroRNA-200c impairs uterine receptivity formation by targeting FUT4 and α1,3-fucosylation. Cell Death Differ 2017;24:2161–72. 10.1038/cdd.2017.136. 28914881.
18. Liang Y, Fu XW, Li JJ, Yuan DS, Zhu SE. DNA methylation pattern in mouse oocytes and their in vitro fertilized early embryos: effect of oocyte vitrification. Zygote 2014;22:138–45. 10.1017/s0967199412000512. 23174120.
19. Zhao X, Hao H, Du W, Zhu H. Effect of vitrification on the microRNA transcriptome in mouse blastocysts. PLoS One 2015;10e0123451. 10.1371/journal.pone.0123451. 25853900.
20. Lee HH, Lee HJ, Kim HJ, Lee JH, Ko Y, Kim SM, et al. Effects of antifreeze proteins on the vitrification of mouse oocytes: comparison of three different antifreeze proteins. Hum Reprod 2015;30:2110–9. 10.1093/humrep/dev170. 26202918.
21. Kim J, Lee J, Lee TB, Jun JH. Embryotrophic effects of extracellular vesicles derived from outgrowth embryos in pre- and peri-implantation embryonic development in mice. Mol Reprod Dev 2019;86:187–96. 10.1002/mrd.23093. 30512223.
22. Gardner DK, Lane M, Stevens J, Schlenker T, Schoolcraft WB. Blastocyst score affects implantation and pregnancy outcome: towards a single blastocyst transfer. Fertil Steril 2000;73:1155–8. 10.1016/s0015-0282(00)00518-5. 10856474.
23. Thompson SM, Onwubalili N, Brown K, Jindal SK, McGovern PG. Blastocyst expansion score and trophectoderm morphology strongly predict successful clinical pregnancy and live birth following elective single embryo blastocyst transfer (eSET): a national study. J Assist Reprod Genet 2013;30:1577–81. 10.1007/s10815-013-0100-4. 24114628.
24. Le Cruguel S, Ferre-L'Hotellier V, Moriniere C, Lemerle S, Reynier P, Descamps P, et al. Early compaction at day 3 may be a useful additional criterion for embryo transfer. J Assist Reprod Genet 2013;30:683–90. 10.1007/s10815-013-9983-3. 23563915.
25. Lee CI, Lee TH, Huang CC, Chen HH, Liu CH, Lee MS. Detection of early cleavage embryos improves pregnancy and delivery rates of Day 3 embryo transfer during in vitro fertilization. Taiwan J Obstet Gynecol 2016;55:558–62. 10.1016/j.tjog.2016.06.005. 27590382.
26. Yang SH, Wu CH, Chen YC, Yang CK, Wu TH, Chen PC, et al. Effect of morphokinetics and morphological dynamics of cleavage stage on embryo developmental potential: a time-lapse study. Taiwan J Obstet Gynecol 2018;57:76–82. 10.1016/j.tjog.2017.12.013. 29458909.
27. Yang ST, Shi JX, Gong F, Zhang SP, Lu CF, Tan K, et al. Cleavage pattern predicts developmental potential of day 3 human embryos produced by IVF. Reprod Biomed Online 2015;30:625–34. 10.1016/j.rbmo.2015.02.008. 25892500.
28. Chu B, Zhong L, Dou S, Wang J, Li J, Wang M, et al. miRNA-181 regulates embryo implantation in mice through targeting leukemia inhibitory factor. J Mol Cell Biol 2015;7:12–22. 10.1093/jmcb/mjv006. 25635127.
29. Galliano D, Pellicer A. MicroRNA and implantation. Fertil Steril 2014;101:1531–44. 10.1016/j.fertnstert.2014.04.023. 24882617.
30. Gross N, Kropp J, Khatib H. MicroRNA signaling in embryo development. Biology (Basel) 2017;6:34. 10.3390/biology6030034. 28906477.
31. Guo C, Zhao D, Zhang Q, Liu S, Sun MZ. miR-429 suppresses tumor migration and invasion by targeting CRKL in hepatocellular carcinoma via inhibiting Raf/MEK/ERK pathway and epithelial-mesenchymal transition. Sci Rep 2018;8:2375. 10.1038/s41598-018-20258-8. 29403024.
32. Ham O, Lee SY, Lee CY, Park JH, Lee J, Seo HH, et al. let-7b suppresses apoptosis and autophagy of human mesenchymal stem cells transplanted into ischemia/reperfusion injured heart 7by targeting caspase-3. Stem Cell Res Ther 2015;6:147. 10.1186/s13287-015-0134-x. 26296645.
33. Kim J, Lee J, Jun JH. Identification of differentially expressed microRNAs in outgrowth embryos compared with blastocysts and non-outgrowth embryos in mice. Reprod Fertil Dev 2019;31:645–57. 10.1071/rd18161. 30428300.
34. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, et al. A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Cancer Res 2008;68:7846–54. 10.1158/0008-5472.can-08-1942. 18829540.
35. Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, et al. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol 2008;10:593–601. 10.1038/ncb1722. 18376396.
36. Kolesnikoff N, Attema JL, Roslan S, Bert AG, Schwarz QP, Gregory PA, et al. Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: implications for epithelial-mesenchymal transition. J Biol Chem 2014;289:11194–205. 10.1074/jbc.m113.529172. 24627491.
37. Ng YH, Rome S, Jalabert A, Forterre A, Singh H, Hincks CL, et al. Endometrial exosomes/microvesicles in the uterine microenvironment: a new paradigm for embryo-endometrial cross talk at implantation. PLoS One 2013;8e58502. 10.1371/journal.pone.0058502. 23516492.
38. Schjenken JE, Zhang B, Chan HY, Sharkey DJ, Fullston T, Robertson SA. miRNA regulation of immune tolerance in early pregnancy. Am J Reprod Immunol 2016;75:272–80. 10.1111/aji.12490. 26804209.
39. Maekawa R, Taketani T, Mihara Y, Sato S, Okada M, Tamura I, et al. Thin endometrium transcriptome analysis reveals a potential mechanism of implantation failure. Reprod Med Biol 2017;16:206–27. 10.1002/rmb2.12030. 29259471.

Article information Continued

Figure 1.

Experimental scheme of the study. One-cell embryos were collected at 22 hours after injection of human chorionic gonadotropin (hCG). Collected embryos were randomly divided into fresh (F) and vitrified-thawed (V) groups. Each group was further subdivided into early cleavage (EC) and delayed cleavage (DC) based on the timing of the third cleavage at 55 hours post-hCG injection. For miRNA analysis, 6 µL of spent blastocyst medium and in vitro-cultured blastocysts were retrieved 127 hours post-hCG injection. After the blastocysts hatched, embryos were cultured for an additional 72 hours to assess developmental competence in vitro. PMSG, pregnant mare’s serum gonadotropin; SBM, spent blastocyst culture medium; dpc, days post coitum.

Figure 2.

Morphology of cultured mouse pre-implantation embryos. Five embryos per group were cultured from the pronuclear-stage to the blastocyst stage in single drops (10 µL) of medium. Culture conditions were maintained across all experimental groups. Representative embryo morphologies are shown at 55 hours post-human chorionic gonadotropin (hCG) injection (1.5 days post coitum [dpc]; A, B, C, D), 79 hours (2.5 dpc; E, F, G, H), 103 hours (3.5 dpc; I, J, K, L), and 127 hours (4.5 dpc; M, N, O, P). Scale bars indicate 100 μm. F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage.

Figure 3.

Pre-implantation embryo quality based on developmental stage and blastomere count. Embryo development, from the pronuclear-stage to the morula (A) and blastocyst (B) stages, was compared among groups. Blastomere numbers in morulae (C) and blastocysts (D) after in vitro culture are also presented. Different letters indicate statistically significant differences (p<0.05). F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage. a),b),c)Different letters indicate statistically different (p<0.05).

Figure 4.

Evaluation of peri-implantation embryos using an outgrowth assay. After hatching, blastocysts were cultured further to assess their outgrowth ability. At 72 hours after in vitro culture, hatched blastocysts were attached to the culture plate (A-a), and trophectoderm (TE, A-b) and inner cell mass (ICM, A-c) were distinguishable. Scale bar indicates 100 μm. Only the timing of the third cleavage was significantly associated with the proportion of outgrowth embryos at 199 hours post-human chorionic gonadotropin (hCG) injection (B). Mean areas and scores for ICM (C, D) and TE (E, F) were comparable across groups. Different letters indicate significant differences (p<0.05). F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage. a),b)Different letters indicate statistically different (p<0.05).

Figure 5.

miRNA-429 expression in spent embryo culture medium (SECM) and blastocysts derived under different culture conditions. Cryopreservation status influenced miRNA-429 expression, which has a putative role in implantation. In the fresh groups, miRNA-429 expression was comparable between EC and DC embryos in both SECM and blastocyst samples (A and C). However, miRNA-429 expression in SECM and blastocysts from DC embryos following cryopreservation was significantly higher than that in EC embryos after vitrification and warming (B and D). F, fresh; V, vitrified-thawed; EC, early cleavage; DC, delayed cleavage.

Table 1.

Mature microRNA-429 sequences of TaqMan probes used for qRT-PCR

Sequence
Position 3057-3063 of PIKFYVE 3′ UTR 5′- ...AUAUACUGACUUAUGCAGUAUUC...-3′
miRNA-429 3′-… UGCCAAAAUGGUCUGUCAUAAU…-5′

qRT-PCR, quantitative reverse transcription-polymerase chain reaction; UTR, untranslated region.