Korean J Fertil Steril Search

CLOSE


Clin Exp Reprod Med > Epub ahead of print
Kim, Kang, Lee, Lee, and Jun: Nicotinamide ameliorates lipopolysaccharide-induced impairment of trophoblastic spheroid outgrowth in an in vitro implantation model

Abstract

Objective

Lipopolysaccharide (LPS), derived from various infectious bacteria in the uterus, interferes with communication between embryonic trophoblasts and endometrial cells, thereby inhibiting successful embryo implantation. This study aimed to investigate the effects of LPS and the anti-inflammatory compound nicotinamide (NAM) on early embryo implantation processes, focusing on the adhesion and outgrowth between trophoblast spheroids and endometrial cells.

Methods

We used JAr mixed JEG-3 (JmJ) spheroids, prepared by combining JAr and JEG-3 cells in a 1:1 ratio. Following treatment with LPS with or without NAM, the attachment and outgrowth of JmJ spheroids on endometrial epithelial cells (ECC-1) were assessed. Additionally, changes in the gene expression of inflammatory cytokines (chemokine (C-X-C motif) ligand 1 [CXCL1], interleukin 8 [IL-8], and IL-33) and cell adhesion molecules (integrin alpha-V [ITGαV], integrin beta 3 [ITGβ3], and integrin beta 5 [ITGβ5]) in ECC-1 cells following LPS and/or NAM treatment were evaluated using quantitative reverse transcription polymerase chain reaction (qRT-PCR) and Western blot analysis.

Results

Decreased attachment rates and reduced outgrowth areas caused by LPS treatment were significantly restored by NAM. These restorative effects of NAM were associated with the modulation of inflammatory cytokines—specifically CXCL1 and IL-33, as shown by qRT-PCR—and expression of the cell adhesion molecule ITGβ3, as indicated by Western blot analysis.

Conclusion

Our study confirmed that LPS-induced endometrial infection may inhibit embryo implantation. NAM treatment ameliorated the detrimental effects of LPS by modulating the expression of inflammatory cytokines and adhesion molecules. Further studies are needed to explore the potential use of NAM as an effective additive to improve embryo implantation rates in human in vitro fertilization-embryo transfer programs.

Introduction

Embryo implantation is a critical step in pregnancy, involving successful interactions between the trophoblast of the blastocyst and epithelial cells of the uterine endometrium. This interaction is finely regulated by various cytokines and adhesion molecules, which collectively mediate the immune challenge presented by the semi-allogenic embryo within the uterine environment [1-3]. The maternal immune system faces a dual task: promoting immune tolerance toward the embryo to sustain a normal pregnancy while defending against potential infections that could threaten fetal development [4-6].
The trophoblast cells originating from the outer layer of the blastocyst are integral to embryo implantation [7]. These cells invade the uterine endometrium, form the placenta, and establish essential communication channels with maternal tissues [1,2]. Successful embryo implantation is marked by intricate interactions between trophoblast cells and endometrial epithelial cells (ECCs), facilitating the formation of a functional placenta capable of nutrient exchange between mother and fetus [2,3]. However, this process creates a significant immune challenge due to the presence of paternal antigens in the embryo, which can trigger a maternal immune response [8,9].
Lipopolysaccharide (LPS), a component of Gram-negative bacterial cell walls, induces inflammatory immune responses via toll-like receptor 4 (TLR-4) in uterine endometrial cells. This inflammatory activation can disrupt the cytokine balance in the uterine endometrium [10,11]. Nicotinamide (NAM) has emerged as an effective anti-inflammatory agent with broad clinical effects, serving as a cellular energy precursor, modulating inflammation through poly-(ADP-ribose) polymerase 1 activation, and contributing to DNA repair, genomic stability, and cellular responses to apoptosis and inflammation [12,13].
ECCs secrete hormones, growth factors, and cytokines essential for successful embryo implantation, with adhesion molecules playing crucial roles in embryo attachment [14,15]. These interactions, mediated by adhesion molecules such as immunoglobulins, cadherins, integrins, and selectins, are vital for cell-to-cell and cell-to-extracellular matrix (ECM) connections [16]. Integrins are transmembrane receptors that facilitate cellular interactions and adhesion. Upon ligand binding, integrins activate signal transduction pathways that regulate cellular functions such as cell cycle progression, cytoskeletal organization, and translocation of new receptors to the cell membrane [17]. This study focused on the integrin alpha-V (ITGαV), integrin beta 3 (ITGβ3), and integrin beta 5 (ITGβ5), aiming to clarify the impact of LPS and NAM on the attachment between trophoblast spheroids and uterine ECCs.
Many in vitro models have significantly advanced our understanding of the embryo implantation process [18,19]. Previous studies have developed in vitro embryo implantation models using trophoblast cells in spheroid form to mimic embryos [7,18,20]. In this study, novel trophoblast spheroids composed of mixed JAr and JEG-3 cells (JmJ), along with human endometrial epithelial cells (ECC-1), were utilized as an in vitro embryo implantation model [21,22]. This study aimed to investigate the effects of LPS and NAM on the early embryo implantation process by examining the attachment and outgrowth between trophoblast spheroids and ECCs.

Methods

1. Culture of human trophoblasts and endometrial epithelial cells

The human trophoblast cell line JEG-3 was cultured in Dulbecco modified eagle medium (Welgene) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (P/S; Lonza). The human trophoblast cell line JAr and ECC-1 endometrial cells were cultured in RPMI 1640 (Welgene) with 10% FBS and 1% P/S. All cells were maintained under standard conditions (37 °C, 5% CO2), with the culture medium replaced every 48 hours. To mimic endometrial infection and inflammatory response caused by Gram-negative bacteria, ECC-1 cells were treated with LPS from Escherichia coli O111 (Sigma-Aldrich).

2. Preparation of JmJ spheroids using the Organoid 3D culture kit

Novel spheroids consisting of JmJ cells were prepared using the Organoid 3D culture kit (Cell Smith). JAr and JEG-3 cells were mixed at a 1:1 ratio to form JmJ spheroids. A total of 1×105 mixed cells in 3 mL were seeded in the Organoid 3D culture kit and incubated for 72 hours. The morphology of the JmJ spheroids was observed using the EVOS XL Core Cell Imaging System (Thermo-Fisher). To mimic embryonic size, only JmJ spheroids with a diameter between 200 and 300 μm were selected for use in this experiment.

3. Evaluation of attachment rate and outgrowth of trophoblast spheroids on ECC-1 cells treated with LPS and NAM

Endometrial ECC-1 cells were cultured in T75 flasks until confluent and then detached using 0.25% trypsin/ethylenediaminetetraacetic acid (EDTA). Approximately 1×105 ECC-1 cells were seeded in 12-well culture plates and cultured until reaching 100% confluence. After ECC-1 cells were treated with LPS (1 and 10 μg/mL) with or without NAM (1 mM) for 24 hours, trophoblast JmJ spheroids were added and co-cultured for an additional 6 hours. The attachment rate of JmJ spheroids to ECC-1 cells was evaluated in a time-dependent manner (0, 1, 2, 4, and 6 hours).
After 72 hours of co-culture, the outgrowth area and spheroid area were analyzed using ImageJ (National Institutes of Health). Outgrowth areas of spheroids were measured in pixels. The outgrowth area ratio, defined as the outgrowth area divided by the spheroid mass area, was calculated as follows:
Outgrowth area ratio =Outgrowth areas of trophoblasts from spheroids Area of spheroid mass.

4. Quantitative analysis of mRNA expression in ECC-1 cells treated with LPS and NAM

Total RNA from ECC-1 cells treated with LPS (1 and 10 μg/mL) with or without NAM (1 mM) for 24 hours was isolated using TRIzol (Ambion). Complementary DNA (cDNA) was synthesized using a cDNA reverse transcription kit (Takara Bio). SYBR-based quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed in a 20-μL reaction volume using StepOne ver. 2.3 (Applied Biosystems) and the SensiFAST SYBR Hi-ROX Kit (Bioline). The reaction mixture included SYBR green master mix, 10 pM of each specific primer, and 1 μL of cDNA per reaction, as shown in Table 1. The qRT-PCR protocol consisted of initial denaturation at 95 °C for 10 minutes, followed by 40 cycles of denaturation at 95 °C for 15 seconds, annealing at the primer-specific temperature for 30 seconds, and extension at 72 °C for 30 seconds. Quantitative analysis was conducted using the 2−ΔΔCt method, with β-actin serving as the internal control [23].
We selected chemokine (C-X-C motif) ligand 1 (CXCL1), interleukin (IL)-8, and IL-33 for analysis based on our preliminary findings, in which IL-1β, IL-6, and tumor necrosis factor alpha (TNF-α) mRNA levels were minimal in ECC-1 cells and responded insufficiently to LPS treatment. In contrast, CXCL1, IL-8, and IL-33 showed robust and reproducible expression changes in response to LPS, making them suitable markers for evaluating the anti-inflammatory effects of NAM.

5. Western blot analysis of ECC-1 cells treated with LPS and NAM

Equal amounts of total protein (20 μg) from ECC-1 cells treated with LPS (1 and 10 μg/mL) with or without NAM (1 mM) for 24 hours were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto nitrocellulose membranes. Membranes were blocked with 5% skim milk in Tris-buffered saline with Tween 20 (Bio-Rad) and incubated with anti-ITGαV (ab179475; Abcam), anti-ITGβ3 (ab197662; Abcam), anti-ITGβ5 (ab31327; Abcam), and anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (SC-32233; Santa Cruz Biotechnology) antibodies. After incubation with the appropriate horseradish peroxidase-linked secondary antibodies (Abcam), signals were visualized using the ChemiDoc MP Imaging System (Bio-Rad). Densitometry was performed using ImageJ, and relative optical densities were calculated by dividing the densitometric values of the ITG proteins by the internal control (GAPDH).

6. Statistical analysis

All experiments were performed at least in triplicate, using more than 100 spheroids per group. Data are presented as mean±standard error of the mean. Statistical differences between the two groups were analyzed by Student t-test. Data were analyzed using Prism GraphPad ver. 5.0 (GraphPad Software). A p-value of less than 0.05 was considered to indicate statistical significance.

Results

1. Effect of LPS and NAM on attachment between JmJ spheroids and ECC-1 cells

The attachment rate between trophoblast JmJ spheroids and ECC-1 was evaluated in a time-dependent manner. Treatment with LPS at both 1 and 10 μg/mL significantly decreased the attachment rate of JmJ spheroids to ECC-1 cells up to 4 hours of co-culture (p<0.05), with recovery observed after 6 hours (Figure 1). However, treatment with 1 mM NAM significantly restored the attachment rate decreased by LPS (1 and 10 μg/mL) for 1, 2, and 4 hours of co-culture (p<0.05).

2. Effect of LPS and NAM on outgrowth between JmJ spheroids and ECC-1 cells

The outgrowth of trophoblast JmJ spheroids on ECC-1 was evaluated after 72 hours of co-culture (Figure 2). Treatment with both 1 and 10 μg/mL of LPS significantly decreased the outgrowth area ratio on ECC-1 cells after 72 hours (p<0.05). However, treatment with 1 mM NAM significantly ameliorated the reduction in outgrowth area induced by LPS at both concentrations (p<0.05) (Figure 3).

3. Effect of LPS and NAM on mRNA expression of adhesion molecules and inflammatory cytokines in ECC-1 cells

To evaluate the effects of LPS and NAM on ECC-1 cells, the mRNA expression of inflammatory cytokines and adhesion molecules was analyzed using qRT-PCR. LPS treatment significantly increased the mRNA expression of CXCL1, IL-8, and IL-33 in ECC-1 cells, while decreasing the expression of ITGβ3 and ITGβ5 (p<0.05). However, ITGαV mRNA expression was unchanged by LPS treatment (Figure 4).
Upon combined treatment with LPS and NAM, the LPS-induced increase in CXCL1 and IL-33 mRNA expression was significantly reversed (p<0.05). Conversely, mRNA expression levels of ITGβ3 and ITGβ5 were not significantly altered by combined NAM and LPS treatment (Figure 4).

4. Effect of LPS and NAM on protein expression of adhesion molecules in ECC-1 cells

To evaluate the effects of LPS and NAM on ECC-1 cells, the protein expression of adhesion molecules (ITGαV, ITGβ3, and ITGβ5) was analyzed using Western blot. As shown in Figure 5, no differences were observed in ITGαV and ITGβ5 expression following treatments with LPS and NAM. However, ITGβ3 expression significantly decreased upon LPS treatment, and this reduction was significantly restored by NAM treatment (p<0.05) (Figure 5C).

Discussion

The present study aimed to elucidate the effects of LPS and NAM on the early stages of embryo implantation, focusing on the attachment and outgrowth of trophoblast spheroids on uterine ECCs. Our findings provide new insights into the molecular mechanisms underlying these processes and highlight the therapeutic potential of NAM for mitigating the adverse effects of inflammation on embryo implantation.
The results demonstrated that LPS, a known inducer of inflammation through TLR-4 activation, significantly impaired both attachment and outgrowth of trophoblast spheroids on ECC-1 cells. These observations align with previous reports indicating that inflammatory conditions within the uterine environment may interfere with embryo implantation and lead to pregnancy complications such as implantation failure or early miscarriage [24,25]. The observed reduction in attachment and outgrowth of trophoblast spheroids following LPS treatment suggests that inflammation disrupts the delicate cytokine and adhesion molecule balance necessary for successful embryo implantation. Our previous study similarly demonstrated that LPS negatively impacts the attachment and outgrowth of JmJ trophoblast spheroids on endometrial ECC-1 cells through modulation of inflammatory responses and cell adhesion [26].
Furthermore, our results suggest that NAM may play a protective role against inflammation-induced disruption of embryo implantation, demonstrating its capacity to significantly mitigate the inhibitory effects of LPS on trophoblast adhesion and outgrowth. NAM, recognized for its anti-inflammatory properties, appears to restore trophoblast attachment and promote outgrowth by modulating the expression of critical adhesion molecules, particularly ITGβ3. We previously reported similar anti-inflammatory effects of NAM against LPS-induced inflammation during MC3T3-E1 osteogenic differentiation [27]. Our findings also align with a recent report indicating that increased TNF-α induced by PM2.5 exposure inhibits extravillous trophoblast cell invasion by activating the reactive oxygen species (ROS)/nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB)/fms-like tyrosine kinase-1 (FLT1) signaling pathway—an adverse effect attenuated by NAM treatment. This suggests potential clinical applications for NAM in mitigating PM2.5-induced intrauterine growth restriction [28].
The qRT-PCR and Western blot analyses further substantiated these findings at the molecular level. The LPS-induced increase in mRNA expression of inflammatory cytokines (CXCL1, IL-8, and IL-33) and the concomitant decrease in the expression of adhesion molecules (ITGβ3 and ITGβ5) underscore how inflammatory conditions negatively impact cellular adhesion and communication. Interestingly, although NAM effectively reversed the LPS-induced increase in CXCL1 and IL-33 mRNA levels, it did not significantly alter ITGβ3 or ITGβ5 expression at the mRNA level, despite restoring ITGβ3 protein levels. This discrepancy between mRNA and protein levels may be attributed to post-transcriptional regulatory mechanisms, such as mRNA stability, translational efficiency, or protein degradation pathways, which can influence protein abundance independent of mRNA expression.
This study provides compelling evidence that LPS-induced inflammation disrupts key processes in early embryo implantation by altering cytokine and adhesion molecule dynamics. NAM emerges as a promising candidate for counteracting these adverse effects, particularly by modulating ITGβ3 expression. These findings not only enhance our understanding of the molecular events involved in embryo implantation but also suggest potential therapeutic strategies to improve pregnancy outcomes under inflammatory conditions. Future studies should explore the precise signaling pathways through which NAM exerts its protective effects and evaluate its clinical utility in managing embryo implantation-related disorders.
This study employed a novel trophoblast spheroid model, the JmJ spheroid, which combines JAr and JEG-3 cells. This approach was designed to better mimic the characteristics of embryonic trophoblasts in vitro by incorporating two distinct trophoblast cell lines rather than relying on a single cell type. Prior research has demonstrated that LPS exerts detrimental effects on the attachment and outgrowth of various trophoblast spheroids on human ECCs [26]. The use of this JmJ spheroid model presents several advantages, as well as certain limitations that should be considered.
A primary advantage of the JmJ spheroid model is its improved biological relevance. By combining JAr and JEG-3 cells, the spheroids reflect the diversity of trophoblast cells present in developing embryos. JAr cells, derived from choriocarcinoma, are known for their proliferative capacity, while JEG-3 cells exhibit invasive properties characteristic of trophoblasts during embryo implantation. Combining these types allows JmJ spheroids to demonstrate both proliferative and invasive behaviors, which are critical aspects of the embryo implantation process [24,29]. Thus, the mixed-cell JmJ spheroid model provides a more realistic in vitro representation of trophoblast behavior compared to spheroids derived from a single cell type.
Another key advantage of the JmJ spheroid model is its potential to improve our understanding of cell-cell interactions during embryo implantation. Interactions between different trophoblast cell types within the spheroid can mimic the complex intercellular signaling and structural organization that occur in vivo. This approach may yield more accurate insights into how trophoblasts coordinate their actions during critical implantation steps, including attachment and invasion into the maternal endometrium, compared to traditional models using only one trophoblast cell type [2,29]. The versatility of the JmJ spheroid model makes it particularly useful for studying how various factors, such as inflammatory agents or therapeutic interventions like NAM, influence these processes.
However, the use of JmJ spheroids also has some disadvantages. One limitation is the increased complexity of interpreting experimental results. The differing behaviors of JAr and JEG-3 cells within the spheroid could lead to variability in outcomes, making it challenging to determine whether observed effects arise from specific cell types or from collective spheroid behavior. This complexity could complicate data analysis and hinder the identification of underlying mechanisms [30].
Additionally, the preparation of JmJ spheroids requires careful control over the ratio and mixing of JAr and JEG-3 cells. Variations in these parameters could produce inconsistencies in spheroid size, composition, and behavior, potentially impacting experimental reproducibility. Ensuring consistency in spheroid formation is critical for generating reliable and interpretable results. Therefore, we implemented a size-selection criterion, selecting only JmJ spheroids with diameters between 200 and 300 μm to closely resemble the size of a human blastocyst.
Although the JmJ spheroid model offers improvements over single-cell-type models, it still does not fully capture the complexity of the physiological trophoblast environment. In vivo, trophoblasts interact with a wide range of other cell types, including immune and endothelial cells, which are absent from this model. Additionally, replicating the ECM composition and mechanical forces of the uterine environment in vitro is challenging. Consequently, while the JmJ spheroid model provides a more realistic representation of trophoblast behavior, it retains limitations that simplify the complexities of actual embryo implantation [7].
Collectively, our findings help elucidate how LPS and NAM influence the attachment and outgrowth of trophoblast spheroids on ECCs in an in vitro embryo implantation model (Figure 6). The results suggest that LPS-induced changes in the expression of inflammatory cytokines and adhesion molecules may relate to the reduced attachment and outgrowth of trophoblast spheroids on ECCs. Moreover, our findings demonstrate the potential of NAM as a therapeutic agent to counteract LPS-induced inhibition of trophoblast attachment and outgrowth. By mitigating inflammatory responses, NAM may improve embryo implantation outcomes and lower the risk of pregnancy-related complications. These observations underscore the need for further investigation into the role of NAM in reproductive health and its broader clinical applications.

Conflict of interest

Jin Hyun Jun is an associate editor of the journal, but he was not involved in the peer reviewer selection, evaluation, or decision process of this article. No other potential conflicts.

Author contributions

Conceptualization: JL, JHJ. Methodology: WK, IK, WL. Formal analysis: WK. Data curation: WK, IK, WL. Funding acquisition: JL, JHJ. Project administration: WK, JL. Visualization: WK, IK. Writing-original draft: WK, IK, JHJ. Writing-review & editing: JL, JHJ. Approval of final manuscript: WK, IK, WL, JL, JHJ.

Figure 1.
Attachment rate of trophoblast mixed JAr and JEG-3 (JmJ) spheroids on endometrial epithelial cells (ECC-1) following treatment with lipopolysaccharide (LPS) and nicotinamide (NAM; 1 mM). ECC-1 cells were divided into five groups: control, LPS (1 μg/mL), LPS (1 μg/mL)+NAM (1 mM), LPS (10 μg/mL), and LPS (10 μg/mL)+NAM (1 mM). Attachment rates were assessed over time (1, 2, 4, and 6 hours). Each experiment was performed at least three times, with more than 100 spheroids per group. Data are presented as mean±standard error of the mean. a)Statistical differences between the two groups were analyzed by Student t-test (p<0.05).
cerm-2024-07472f1.jpg
Figure 2.
Representative images in outgrowth assay of trophoblastic mixed JAr and JEG-3 (JmJ) spheroids on endometrial epithelial cells (ECC-1) treated with lipopolysaccharide (LPS) and nicotinamide (NAM). Outgrowth areas of spheroids were measured after 72 hours of co-culture. Ratio of outgrowth area was calculated with Image J. (A) A 1 μg of LPS treatment, (B) 1 μg of LPS+1 mM NAM treatment, (C) 10 μg of LPS treatment, and (D) 10 μg of LPS+1 mM NAM treatment. Scale bars were 400 μm.
cerm-2024-07472f2.jpg
Figure 3.
Ratio of the outgrowth area of trophoblast mixed JAr and JEG-3 (JmJ) spheroids on endometrial epithelial cells (ECC-1) treated with lipopolysaccharide (LPS) and nicotinamide (NAM). Outgrowth areas were measured after 72 hours of co-culture, and ratios were quantified using ImageJ. Each experiment was performed at least three times, with more than 100 spheroids per group. Data are presented as mean±standard error of the mean. a)Significant differences between the two groups were analyzed by Student t-test (p<0.05).
cerm-2024-07472f3.jpg
Figure 4.
Quantitative analysis of mRNA expression in endometrial epithelial cells (ECC-1) treated with lipopolysaccharide (LPS) and nicotinamide (NAM) for 24 hours. Quantitative reverse transcription polymerase chain reaction was used to assess inflammatory cytokines (A) and adhesion molecules (B). Data are presented as mean±standard error of the mean. CXCL1, chemokine (C-X-C motif) ligand 1; IL, interleukin; ITGαV, integrin alpha-V; ITGβ3, integrin beta 3; ITGβ5, integrin beta 5. Significant differences between the two groups were analyzed by Student t-test: a)p<0.05; b)p<0.01.
cerm-2024-07472f4.jpg
Figure 5.
Western blot analysis of integrin alpha-V (ITGαV), integrin beta 3 (ITGβ3), and integrin beta 5 (ITGβ5) in endometrial epithelial cells (ECC-1) treated with lipopolysaccharide (LPS) and nicotinamide (NAM) for 24 hours. (A) Representative blots for ITGαV, ITGβ3, ITGβ5, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH). (B–D) Densitometric quantification of ITGαV (B), ITGβ3 (C), and ITGβ5 (D). Data are presented as mean±standard error of the mean. a)Significant differences between the two groups were analyzed by Student t-test (p<0.05).
cerm-2024-07472f5.jpg
Figure 6.
Schematic representation of the effects of lipopolysaccharide (LPS) and nicotinamide (NAM) on the attachment and outgrowth of trophoblast spheroids on endometrial epithelial cells (ECC-1). LPS treatment alters inflammatory cytokine and adhesion molecule expression, leading to impaired spheroid attachment and outgrowth. NAM co-treatment ameliorates these effects by restoring cytokine and adhesion molecule levels. Red arrows indicate the deleterious effects of LPS; blue lines indicate the restorative effects of NAM.
cerm-2024-07472f6.jpg
Table 1.
Primer sequences of inflammatory cytokines, adhesion molecules and an internal control
Gene Primer sequence Product size (bp) GenBank accession number Annealing temperature (°C)
CXCL1 F : CACCTGGATTGTGCCTAATGT 273 NM_001511.4 60
R : TTGCAGGCTCCTCAGAAATA
IL-8 F : GGCACAAACTTTCAGAGACAG 153 NG_029889.1 60
R : ACACAGAGCTGCAGAAATCAGG
IL-33 F : GTGACGGTGTTGATGGTAAGA 349 NM_001314044.2 60
R : CCTTCTCCAGTGGTAGCATTT
ITGαV F : AATCTTCCAATTGAGGATATCAC 140 NM_001145000.3 61
R : AAAACAGCCAGTAGCAACAAT
ITGβ3 F : AGTCAGGGAGAGCTGAACTA 294 NM_000212.3 60
R : GGGTGTGGAATTAGGAGGTAAA
ITGβ5 F : TAGGTAGGCACCACAGAGAA 219 NM_002213.5 60
R : CAGCCCAGCATCTCAGTATTT
β-Actin F : CATGTACGTTGCTATCCAGGC 250 NM_001101.5 60
R : CTCCTTAATGTCACGCACGAT

CXCL1, CXC motif ligand 1; IL, interleukin; ITG, integrin; F, forward; R, reverse.

References

1. Cha J, Sun X, Dey SK. Mechanisms of implantation: strategies for successful pregnancy. Nat Med 2012;18:1754-67.
crossref pmid pmc pdf
2. Aplin JD, Myers JE, Timms K, Westwood M. Tracking placental development in health and disease. Nat Rev Endocrinol 2020;16:479-94.
crossref pmid pdf
3. Shibata S, Endo S, Nagai LA, Kobayashi EH, Oike A, Kobayashi N, et al. Modeling embryo-endometrial interface recapitulating human embryo implantation. Sci Adv 2024;10:eadi4819.
crossref pmid pmc
4. Xu L, Li Y, Sang Y, Li DJ, Du M. Crosstalk between trophoblasts and decidual immune cells: the cornerstone of maternal-fetal immunotolerance. Front Immunol 2021;12:642392.
crossref pmid pmc
5. Shen L, Wang W, Hou W, Jiang C, Yuan Y, Hu L, et al. The function and mechanism of action of uterine microecology in pregnancy immunity and its complications. Front Cell Infect Microbiol 2023;12:1025714.
crossref pmid pmc
6. Anoshko Y, Dons'koi B, Sudoma I, Khazhylenko K, Zabara D, Goncharova Y. Changes in the immunophenotype of endometrium during implantation window receptivity formation in healthy fertile women. Placenta 2023;143:62-8.
crossref pmid
7. Abbas Y, Turco MY, Burton GJ, Moffett A. Investigation of human trophoblast invasion in vitro. Hum Reprod Update 2020;26:501-13.
crossref pmid pmc pdf
8. Peng L, Zhao W, Yin T, Xu C, Wang G, Du M. The unique expression pattern of human leukocyte antigen in trophoblasts potentially explains the key mechanism of maternal-fetal tolerance and successful pregnancy. J Reprod Immunol 2023;158:103980.
crossref pmid
9. Jena SR, Nayak J, Kumar S, Kar S, Samanta L. Comparative proteome profiling of seminal components reveal impaired immune cell signalling as paternal contributors in recurrent pregnancy loss patients. Am J Reprod Immunol 2023;89:e13613.
crossref pmid pdf
10. Firmal P, Shah VK, Chattopadhyay S. Insight into TLR4-mediated immunomodulation in normal pregnancy and related disorders. Front Immunol 2020;11:807.
crossref pmid pmc
11. Deb K, Chaturvedi MM, Jaiswal YK. Gram-negative bacterial LPS induced poor uterine receptivity and implantation failure in mouse: alterations in IL-1beta expression in the preimplantation embryo and uterine horns. Infect Dis Obstet Gynecol 2005;13:125-33.
crossref pmid pmc
12. Chen Q, Cui K, Zhao Z, Xu X, Liu Y, Shen Y, et al. LPS stimulation stabilizes HIF-1α by enhancing HIF-1α acetylation via the PARP1-SIRT1 and ACLY-Tip60 pathways in macrophages. FASEB J 2022;36:e22418.
crossref pmid
13. Rehman IU, Ahmad R, Khan I, Lee HJ, Park J, Ullah R, et al. Nicotinamide ameliorates amyloid beta-induced oxidative stress-mediated neuroinflammation and neurodegeneration in adult mouse brain. Biomedicines 2021;9:408.
crossref pmid pmc
14. Massimiani M, Lacconi V, La Civita F, Ticconi C, Rago R, Campagnolo L. Molecular signaling regulating endometrium-blastocyst crosstalk. Int J Mol Sci 2019;21:23.
crossref pmid pmc
15. Tvaroska I, Kozmon S, Kona J. Molecular modeling insights into the structure and behavior of integrins: a review. Cells 2023;12:324.
crossref pmid pmc
16. Campbell ID, Humphries MJ. Integrin structure, activation, and interactions. Cold Spring Harb Perspect Biol 2011;3:a004994.
crossref pmid pmc
17. Pang X, He X, Qiu Z, Zhang H, Xie R, Liu Z, et al. Targeting integrin pathways: mechanisms and advances in therapy. Signal Transduct Target Ther 2023;8:1.
crossref pmid pmc pdf
18. You Y, Stelzl P, Zhang Y, Porter J, Liu H, Liao AH, et al. Novel 3D in vitro models to evaluate trophoblast migration and invasion. Am J Reprod Immunol 2019;81:e13076.
crossref pmid pdf
19. Uchida H, Maruyama T, Ohta K, Ono M, Arase T, Kagami M, et al. Histone deacetylase inhibitor-induced glycodelin enhances the initial step of implantation. Hum Reprod 2007;22:2615-22.
crossref pmid
20. Weimar CH, Post Uiterweer ED, Teklenburg G, Heijnen CJ, Macklon NS. In-vitro model systems for the study of human embryo-endometrium interactions. Reprod Biomed Online 2013;27:461-76.
crossref pmid
21. Buck VU, Gellersen B, Leube RE, Classen-Linke I. Interaction of human trophoblast cells with gland-like endometrial spheroids: a model system for trophoblast invasion. Hum Reprod 2015;30:906-16.
crossref pmid
22. Wang H, Pilla F, Anderson S, Martinez-Escribano S, Herrer I, Moreno-Moya JM, et al. A novel model of human implantation: 3D endometrium-like culture system to study attachment of human trophoblast (Jar) cell spheroids. Mol Hum Reprod 2012;18:33-43.
crossref pmid
23. Rao X, Huang X, Zhou Z, Lin X. An improvement of the 2ˆ(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat Bioinforma Biomath 2013;3:71-85.
pmid pmc
24. Cotechini T, Komisarenko M, Sperou A, Macdonald-Goodfellow S, Adams MA, Graham CH. Inflammation in rat pregnancy inhibits spiral artery remodeling leading to fetal growth restriction and features of preeclampsia. J Exp Med 2014;211:165-79.
crossref pmid pmc pdf
25. Huang G, Yao D, Yan X, Zheng M, Yan P, Chen X, et al. Emerging role of toll-like receptors signaling and its regulators in preterm birth: a narrative review. Arch Gynecol Obstet 2023;308:319-39.
crossref pmid pdf
26. Kim W, Choi J, Yoon H, Lee J, Jun JH. Detrimental effects of lipopolysaccharide on the attachment and outgrowth of various trophoblastic spheroids on human endometrial epithelial cells. Clin Exp Reprod Med 2021;48:132-41.
crossref pmid pmc pdf
27. Kang I, Koo M, Jun JH, Lee J. Effect of nicotinamide mononucleotide on osteogenesis in MC3T3-E1 cells against inflammation-induced by lipopolysaccharide. Clin Exp Reprod Med 2024;51:236-46.
crossref pmid pmc pdf
28. Tao S, Zhang X, Yang L, Yang M, Pan B, Xu Y, et al. Nicotinamide improves the impaired extravillous trophoblast cell invasion induced by PM2.5 exposure-associated increase of TNFα secretion through the ROS/NF-κB/FLT1 pathway. Ecotoxicol Environ Saf 2024;282:116733.
crossref pmid
29. Esfandyari S, Elkafas H, Chugh RM, Park HS, Navarro A, Al-Hendy A. Exosomes as biomarkers for female reproductive diseases diagnosis and therapy. Int J Mol Sci 2021;22:2165.
crossref pmid pmc
30. Moffett A, Shreeve N. Local immune recognition of trophoblast in early human pregnancy: controversies and questions. Nat Rev Immunol 2023;23:222-35.
crossref pmid pmc pdf
TOOLS
Share :
Facebook Twitter Linked In Google+ Line it
METRICS Graph View
  • 0 Crossref
  •   Scopus
  • 939 View
  • 18 Download
Related articles in Clin Exp Reprod Med


ABOUT
ARTICLE CATEGORY

Browse all articles >

BROWSE ARTICLES
AUTHOR INFORMATION
Editorial Office
Department of Obstetrics and Gynecology, Seoul National University Bundang Hospital
82 Gumi-ro 173, Bundang-gu, Seongnam 13620, Korea
Tel: +82-31-787-7254    CP: +82-10-9072-3154    E-mail: blasto@snubh.org                

Copyright © 2026 by Korean Society for Reproductive Medicine.

Developed in M2PI

Close layer
prev next