Effects of dibutyl phthalate on early implantation events with human endometrial cells and trophoblast spheroid model

Wonmo Lee; Inyoung Kang; Jin Hyun Jun; Jaewang Lee

doi:10.5653/cerm.2025.07843

Clin Exp Reprod Med > Epub ahead of print

Lee, Kang, Jun, and Lee: Effects of dibutyl phthalate on early implantation events with human endometrial cells and trophoblast spheroid model

Original Article

Clinical and Experimental Reproductive Medicine 2025;cerm.2025.07843.

Published online: December 24, 2025

DOI: https://doi.org/10.5653/cerm.2025.07843

Effects of dibutyl phthalate on early implantation events with human endometrial cells and trophoblast spheroid model

Wonmo Lee¹

, Inyoung Kang¹

, Jin Hyun Jun²

, Jaewang Lee²

¹Department of Senior Healthcare, Eulji University, Uijeongbu, Republic of Korea

²Department of Biomedical Laboratory Science, Eulji University, Seongnam, Republic of Korea

Corresponding author: Jin Hyun Jun Department of Biomedical Laboratory Sciences, Eulji University, Jicheon B/D, suite B106, 553 Sanseong-daero, Sujeong-gu, Seongnam 13135, Republic of Korea
Tel: +82-31-740-7210 Fax: +82 31-787-4054 E-mail: junjh55@hanmail.net

Co-corresponding author: Jaewang Lee Department of Biomedical Laboratory Sciences, Eulji University, Jicheon B/D, suite B115, 553 Sanseong-daero, Sujeong-gu, Seongnam 13135, Republic of Korea
Tel: +82-31-740-7144 Fax: +82-31-787-4054 E-mail: wangjaes@gmail.com

Received January 22, 2025 Revised July 3, 2025 Accepted July 10, 2025

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (https://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objective

This study investigates the estrogenic activity of dibutyl phthalate (DBP) and its potential effects on endometrial receptivity and early embryo implantation. Given its widespread exposure and structural similarities to endocrine-disrupting chemicals, the potential for DBP to interfere with implantation—a key factor in fertility—is explored.

Methods

The optimal concentration of DBP was determined using the Cell Counting Kit-8 assay. Gene and protein expression related to attachment, estrogen receptor signaling, and inflammation were analyzed by reverse transcription quantitative polymerase chain reaction and western blotting. Immunocytochemistry was used to assess the nuclear translocation of estrogen receptor alpha (ERα), while attachment and outgrowth assays evaluated the effects of DBP on trophoblast behavior. Statistical analyses were performed using GraphPad Prism 5.01 (GraphPad Software) and SPSS ver. 18.0 (SPSS Inc.).

Results

DBP did not show cytotoxicity in Ishikawa cells at concentrations of 1, 10, and 100 μM. DBP treatment upregulated the expression of genes related to attachment, estrogen receptor signaling, and inflammation. Protein analysis showed an increase in inflammation-related proteins, and DBP enhanced ERα nuclear translocation. In trophoblast experiments, DBP-treated cells exhibited slightly lower attachment rates at early time points, but no significant differences were observed after 1 hour. DBP also reduced the outgrowth area of JEG-3 cells, with a significant decrease observed at 100 μM.

Conclusion

DBP exhibits estrogenic activity, disrupting implantation and invasion, and may pose risks to female reproductive health. These findings highlight the need for further investigation into the long-term effects of DBP exposure.

Keywords: Dibutyl phthalate; Endocrine disruptors; Implantation; Infertility; Ishikawa cell; Jeg-3 cell; Reproduction

Introduction

Infertility is defined as the inability to conceive after 1 year of regular unprotected intercourse [1]. It can result from factors affecting either the male or female partner. In women, common causes include ovulatory and menstrual disorders, fallopian tube damage, implantation failure, and hormonal abnormalities [2,3]. Over the past few decades, the prevalence of infertility has increased, accompanied by rising costs of assisted reproductive technologies [4]. Implantation failure is a major contributor to infertility and is influenced by factors such as the timing of the implantation window, endometrial receptivity, uterine conditions, embryonic factors, immune responses, and hormonal imbalances [5]. Early embryo implantation is crucial for pregnancy, and its disruption is a leading cause of pregnancy failure [6]. This process involves the fertilized embryo implanting into the uterus and fully invading the endometrial tissue [7]. Because endometrial receptivity is maintained for only a short period during implantation, the interaction between endometrial receptivity and embryo development is critical for successful implantation.

Endocrine-disrupting chemicals (EDCs) are increasingly recognized as harmful substances that interfere with hormone metabolism, cellular function, and biosynthesis. Commonly found in food, consumer products, and the environment, EDCs disrupt homeostasis and reproductive function [8-10]. Because of their structural similarities to natural hormones, EDCs can alter hormone levels and disturb biological balance [11,12]. Additionally, EDCs can bind to sex hormone receptors, either inhibiting or activating hormone production; this activity ultimately disrupts hormonal pathways and cellular signaling processes [13,14].

Phthalates are widely used in industries such as plastics manufacturing, cosmetics, medical supplies, and building materials, and are commonly detected in food. Their primary function is as plasticizers, enhancing the flexibility and durability of plastics [15-17]. Human exposure to phthalates has been linked to adverse health effects, including endocrine system toxicity and reproductive dysfunction [15,18]. Among phthalates, di(2-ethylhexyl) phthalate (DEHP) is the most widely used. This compound is employed in the production of plastic-based products such as medical devices, household appliances, and vinyl flooring. Exposure to DEHP has been associated with menstrual irregularities and hormonal disruptions [19,20]. Dibutyl phthalate (DBP) shares structural similarities with DEHP, potentially contributing to similar biological effects [6]. Although DBP does not structurally resemble estrogen, it can interact with estrogen receptors (ERs) and induce estrogen-like physiological effects [7]. DBP is primarily used as a plasticizer in plastics but is also found in cosmetics, paints, printing inks, and pharmaceuticals [21]. Despite its widespread exposure, the full extent of DBP's effects remains poorly understood, necessitating further research.

Previous studies have demonstrated that phthalates adversely affect implantation processes. Specifically, DEHP has been implicated in implantation failure, reduced embryo size, and increased rates of pregnancy loss and miscarriage. Di-isobutyl phthalate (DIBP), a known alternative to DBP, has also been associated with increased post-implantation loss [22]. However, the specific effects of DBP on implantation remain underexplored, indicating a notable gap in the current literature. Therefore, this study utilized endometrial cells and trophoblast cell spheroids to investigate the estrogenic activity of DBP and its effects on endometrial receptivity and early embryo implantation.

Methods

1. Cell culture and trophoblast spheroid formation

Ishikawa and JEG-3 cells were cultured in Dulbecco modified Eagle medium (DMEM; Welgene) supplemented with 10% fetal bovine serum (FBS; Gibco) and 1% penicillin-streptomycin (P/S; Lonza). JEG-3 cell spheroids were formed in 96-well plates (SPL Life Sciences). The plates were treated with an anti-adhesion rinsing solution (Stemcell Technologies) for 30 minutes, followed by two washes with Ca²⁺/Mg²⁺-free phosphate-buffered saline (PBS; Biowest). A total of 100 μL of 10% FBS DMEM was dispensed into each well, and 300 JEG-3 cells were seeded per well. Cells were incubated on an orbital shaker at 80 rpm for 48 hours at 37 °C in a 5% CO₂ atmosphere to facilitate spheroid formation.

2. Cytotoxicity assay

Cell toxicity was assessed using the Cell Counting Kit-8 (CCK-8; Dojindo) assay. Ishikawa cells were seeded at 1×10³ cells per well in 96-well plates and exposed to DBP concentrations ranging from 1 to 100 μM for 72 hours. Following incubation, 10 μL of CCK-8 reagent was added to each well, and cells were incubated for an additional hour at 37 °C. Absorbance at 450 nm was measured using a MultiskanGO (Thermo Fisher Scientific). The control group consisted of cells treated with 1% FBS in DMEM containing 0.1% dimethyl sulfoxide (DMSO).

3. Reverse transcription quantitative polymerase chain reaction

Ishikawa cells were seeded at 1×10⁵ cells per well in 6-well plates (SPL Life Sciences). The cells were treated with DBP at concentrations of 1, 10, and 100 μM for 8 hours. Total RNA was extracted using TRIzol (Invitrogen). For reverse transcription quantitative polymerase chain reaction (RT-qPCR) analysis, 500 ng of total RNA was reverse-transcribed into complementary DNA (cDNA) using the PrimeScript 1st Strand cDNA Synthesis Kit (Takara Bio Inc.). RT-qPCR was performed using primers (BIONEER) and SYBR Green (Meridian Bioscience). The following target genes were analyzed: attachment-related markers (leukemia inhibitory factor [LIF] and integrin alpha V [ITGαV]), estrogen receptor alpha (ERα) signaling-related markers (ERα, aryl hydrocarbon receptor [AHR], AHR nuclear translocator [ARNT], and cytochrome P450 family 1 subfamily A member 1 [CYP1A1]), and inflammation-related markers (interleukin 6 [IL-6], IL-1β, and tumor necrosis factor-α [TNF-α]). The primer sequences used in this experiment are listed in Table 1, and all data were normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH). All experiments were performed in at least triplicate. The PCR conditions were as follows: an initial hold at 95 °C for 15 minutes, followed by denaturation at 95 °C for 30 seconds, annealing at 61 °C for 30 seconds, and extension at 72 °C for 30 seconds [23].

4. Western blotting

Ishikawa cells were seeded at 1×10⁶ cells per 60-mm dish (SPL Life Sciences). Total protein was isolated using radioimmunoprecipitation assay lysis buffer (Thermo Fisher Scientific) with protease inhibitors (Thermo Fisher Scientific). Total protein concentration was determined using the bicinchoninic acid assay (Thermo Fisher Scientific). A total of 15 μg of protein was used. For protein separation, 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis was performed, and proteins were transferred to a polyvinylidene fluoride membrane (Thermo Fisher Scientific). The membrane was blocked with 5% skim milk in 1X Tris-buffered saline containing 0.1% Tween 20 (TBST) for 2 hours at room temperature. Primary antibodies for GAPDH (1:5,000; Santa Cruz Biotechnology), LIF (1:1,000; Santa Cruz Biotechnology), ITGαV (1:5,000; Abcam), ERα (1:500; ABclonal), IL-6 (1:500; Abcam), and TNF-α (1:500; Abcam) were incubated with the membrane overnight at 4 °C on an orbital shaker. The membrane was then washed three times for 5 minutes with TBST. For GAPDH, the membrane was incubated with an anti-mouse peroxidase-conjugated immunoglobulin G (IgG) secondary antibody for 2 hours at room temperature. For LIF, ITGαV, ERα, IL-6, and TNF-α, anti-rabbit peroxidase-conjugated IgG secondary antibodies were used for 2 hours at room temperature. For protein detection, the Immobilon Forte Western HRP substrate (ECL; Merck Millipore) was applied, and results were analyzed using an iBright CL750 imaging system (Applied Biosystems). All data were quantified using ImageJ (National Institutes of Health).

5. Fluorescence immunocytochemistry

To exclude experimental variables, serum starvation was applied throughout all processes. Ishikawa cells were treated with DBP at concentrations of 1, 10, and 100 μM for 2 hours. As a positive control, Ishikawa cells were treated with 1 μM 17β-estradiol (E2; Sigma-Aldrich) for 2 hours. Cell culture slides (SPL Life Sciences) were loaded with 500 μL of cell culture media per well, seeded with 1×10⁴ Ishikawa cells, and incubated for at least 8 hours. After removing the media, 500 μL of DBP treatment medium was added, and the cells were incubated for 30 minutes. The treatment medium was then removed, and the cells were washed three times for 3 minutes each with PBS. The cells were then fixed overnight with 4% paraformaldehyde (Biosesang). After fixation, cells were washed three times with PBS for 3 minutes each and permeabilized with 500 μL of 0.1% Triton for 30 minutes at room temperature. Following another PBS wash, cells were blocked with 5% bovine serum albumin (BSA) for 2 hours at room temperature. The primary antibody, ERα, was incubated overnight at 4 °C, followed by incubation with the secondary antibody, Alexa 488, for 2 hours at room temperature. Cells were then washed with 0.5% BSA, stained with 4′,6-diamidino-2-phenylindole (DAPI) mounting solution (Vector Laboratories), and mounted with cover glass (Dako). Immunocytochemistry images were captured using a Nikon Eclipse 80i microscope (Nikon) and analyzed with iSolution Auto Plus (IMT i-solution Inc.). Merged images were processed using ImageJ.

6. Attachment assay using trophoblast spheroids

JEG-3 spheroids were constructed over 48 hours, with 300 JEG-3 cells per spheroid. Spheroids with sizes ranging from 200 to 300 μm were used in the study. In a 48-well plate (SPL Life Sciences), 300 μL of 10% FBS medium was dispensed per well, and Ishikawa cells were seeded at 3×10⁴ cells per well. After 24 hours, the cells were washed once with 300 μL of PBS and then incubated for 48 hours with 300 μL of 1% FBS in DMEM treated with various concentrations of DBP. The cells were washed twice with 300 μL of PBS and then replaced with 300 μL of 10% FBS in DMEM. JEG-3 spheroids were placed on top of the Ishikawa cells and incubated for 10 minutes, 30 minutes, and 1 hour. The attachment rate was measured by setting the orbital shaker to 200 rpm and shaking for 5 minutes, as shown in Figure 1A. The attachment assay conducted in this study is depicted in Figure 2A.

7. Outgrowth assay using trophoblast spheroids

In a 48-well plate, 300 μL of 10% FBS in DMEM was dispensed per well, and Ishikawa cells were seeded at a density of 2×10⁴ cells per well. After 24 hours, the cells were washed once with 300 μL of PBS and incubated for 48 hours with 300 μL of 1% FBS in DMEM treated with varying concentrations of DBP. The cells were then washed twice with 300 μL of PBS and replenished with 300 μL of 10% FBS in DMEM. JEG-3 cells were seeded on top of the DBP-treated Ishikawa cells and incubated at 37 °C with 5% CO₂ for 72 hours. The outgrowth rate was measured, and images of the outgrowth were captured using an EVOS M500 imaging system (Thermo Fisher Scientific). The outgrowth area was estimated using ImageJ. The outgrowth assay conducted in this study is depicted in Figure 2A.

8. Statistical analysis

All data were analyzed using GraphPad Prism 5.01 (GraphPad Software) and SPSS Window ver. 18.0 (SPSS Inc.). Experiments were performed in at least triplicate, and values are expressed as mean±standard error of the mean. One-way analysis of variance with the Tukey post hoc test was employed for most experimental results, while chi-square (χ²) analysis was used for attachment rates. For all analyses, p-values of less than 0.05 were considered to indicate statistical significance.

Results

1. Effect of DBP on the viability of Ishikawa cells

To evaluate the cytotoxicity of DBP in Ishikawa cells, the cells were treated with DBP at concentrations of 1, 10, and 100 μM for 72 hours. The CCK-8 assay results showed no cytotoxic effects at any concentration (Figure 2B). In subsequent experiments, the cells were treated with 0.1, 1, and 10 μM DBP, and a cytotoxicity test was conducted again to confirm the absence of cytotoxic effects.

2. DBP-induced gene expression in Ishikawa cells

To investigate the effect of DBP on Ishikawa cells, mRNA expression was analyzed using RT-qPCR. The expression of attachment markers was upregulated in DBP-treated Ishikawa cells. Among attachment-related genes, the mRNA expression of LIF and ITGαV was significantly upregulated in the DBP-treated groups compared to the control group (Figure 3A). Regarding ERα signaling-related genes, the expression of ERα, ARNT, AHR, and CYP1A1 was significantly upregulated in the DBP-treated groups compared to the control group (Figure 3B). Inflammation-related genes, including IL-6, IL-1β, and TNF-α, also displayed significantly higher expression in the DBP-treated groups compared to the control group (Figure 3C). These results suggest that DBP influences attachment, ERα signaling, and inflammation in endometrial cells, as evidenced by the changes observed at the mRNA level.

3. DBP-induced protein expression in Ishikawa cells

To assess protein levels in DBP-treated Ishikawa cells, the expression of attachment-related proteins (LIF and ITGαV) and inflammation-related proteins (IL-6, IL-1β, and TNF-α) was measured. In the previous experiment, the mRNA expression of LIF, ITGαV, IL-6, IL-1β, and TNF-α was found to be elevated in the DBP-treated groups. The current analysis aimed to determine whether these increases in mRNA expression corresponded to increased protein levels, as measured by Western blot assay. Protein levels were modestly elevated in all DBP-treated groups, with statistically significant increases observed in the levels of inflammation-related proteins (Figure 4).

4. Fluorescence immunocytochemistry of DBP-treated Ishikawa cells

Fluorescence immunocytochemistry was performed to evaluate the intranuclear translocation of ERα. Immunofluorescence intensity was significantly increased in the DBP-treated group compared to the control group (Figure 5). To confirm the estrogen-positive behavior of Ishikawa cells—a known ERα-positive cell line—1 μM 17β-E2 was used as a positive control. Following 2 hours of DBP exposure, ERα nuclear translocation was enhanced in a dose-dependent manner. These findings suggest that DBP may promote ERα-mediated responses or exert other estrogenic effects on the endometrium.

5. Reduced trophoblastic spheroid attachment on DBP-treated endometrial cells

As observed in the previous experiment, the expression of the attachment-related marker LIF was elevated at both the mRNA and protein levels, suggesting that DBP may enhance spheroid attachment. To evaluate the attachment rate of spheroids to DBP-treated Ishikawa cells, attachment assays were conducted (Figure 6A). Early attachment rates (at 10 and 30 minutes) were slightly lower in the DBP-treated groups compared to the control group. After 1 hour, however, no significant difference in attachment rate was observed among the experimental groups (Figure 6B).

6. Reduced trophoblastic spheroid outgrowth on DBP-treated endometrial cells

To investigate the effect of DBP on the outgrowth of JEG-3 cells on Ishikawa cells, an outgrowth assay was performed. After treating Ishikawa cells with varying concentrations of DBP, JEG-3 cells were seeded on top of the Ishikawa cells and co-cultured (Figure 1A). The outgrowth area was slightly reduced in the DBP-treated groups, with a significant decrease observed in the 100 μM DBP group. These results suggest that DBP negatively affected the outgrowth area, despite the absence of significant differences in the levels of attachment-related proteins (Figure 1B).

Discussion

In this study, we examined the adverse effects of DBP on early implantation and invasion processes using a three-dimensional (3D) cell culture model derived from human cancer cell lines. To evaluate the potential risks and impact of DBP on female infertility, it is essential to use models that represent both the endometrium and the embryo. DBP exhibited estrogenic activity, induced an inflammatory environment, and significantly increased the mRNA levels of IL-6, IL-1β, and TNF-α. Elevated protein levels of IL-6 and TNF-α were also observed. Additionally, both the attachment rate and outgrowth area were reduced. However, the precise mechanisms underlying the effects of DBP remain unclear.

To assess the impact of DBP on endometrial cells, non-cytotoxic concentrations were determined using the CCK-8 assay. Exposure to DBP at concentrations of 1, 10, and 100 μM for 72 hours did not affect the viability of Ishikawa endometrial cells. Although human exposure to EDCs generally occurs at low concentrations over prolonged periods [24,25], maintaining cell cultures under such conditions is impractical. Therefore, this study used higher concentrations of DBP over shorter periods while avoiding cytotoxic effects.

The influence of DBP on mRNA expression was analyzed using quantitative RT-qPCR. To assess its impact on the endometrium, markers associated with attachment, ERα signaling, and inflammation were examined [26]. During implantation, the embryo releases cytokines related to attachment and inflammation, which affect both the endometrium and the embryo. IL-6, IL-1β, and TNF-α were assessed as inflammation markers, while LIF and ITGαV, which are released by the embryo, were evaluated for their role in attachment [27]. The interaction between IL-6 and LIF has been well-documented [28,29]. The significant increase in mRNA and protein levels of IL-6, TNF-α, and IL-1β in DBP-treated endometrial cells suggests that DBP induces an inflammatory environment affecting both the embryo and the endometrium. Additionally, the expression levels of ERα, AHR, ARNT, and CYP1A1 were significantly elevated in the DBP-treated groups, indicating that DBP exhibits estrogen-like activity in Ishikawa cells. To further examine the effects of DBP on the ERα signaling pathway, we also analyzed the expression of AHR, ARNT, and CYP1A1. AHR, a receptor responsive to environmental pollutants, is known to induce inflammation through the AHR pathway, particularly in response to phthalates [30]. Upon ligand binding, AHR forms a heterodimer with ARNT and translocates into the nucleus, promoting gene transcription [31]. This leads to increased expression of CYP1A1, a cytochrome P450 enzyme involved in metabolizing toxic substances. CYP1A1 produces highly reactive metabolites, including 2-hydroxylation, 4-hydroxylation, and 16α-hydroxylation products; these may contribute to DNA damage or mutations, although this remains unclear [32,33]. In this study, the gene expression levels of ERα, AHR, ARNT, and CYP1A1 increased in a concentration-dependent manner, indicating that DBP activates the AHR pathway. Immunofluorescence staining further demonstrated that DBP treatment at high concentrations enhanced ERα nuclear translocation, similar to the effects of E2.

Western blot analysis was conducted to investigate protein expression changes corresponding to the observed mRNA expression alterations. Protein levels of LIF, ITGαV, ERα, TNF-α, and IL-6 were measured. In DBP-treated cells, significant increases were observed only in inflammation-related proteins. These findings suggest that DBP induces an inflammatory environment in the endometrium, potentially impairing implantation. Interestingly, these effects were more pronounced at lower concentrations, while no significant changes were observed at higher concentrations. This discrepancy may be due to the short exposure duration, which could have been insufficient to detect all expression-related responses. Further research is needed to elucidate the regulatory effects of DBP on gene expression related to attachment, its relationship with inflammatory cytokines, and its potential reproductive toxicity in women.

To evaluate the effect of DBP on endometrial implantation, an attachment assay was conducted. DBP-treated endometrial cells were used to simulate the effects of EDC exposure on the endometrium. While early attachment rates were slightly higher in the DBP-treated group, attachment rates significantly decreased after 10 and 30 minutes compared to the control group. A limitation of this experiment is the use of cancer cell lines, which possess high adhesion and proliferation rates that may have influenced spheroid attachment behavior.

The outgrowth assay assessed the invasion of embryos into DBP-treated endometrial cells. In this model, DBP-treated Ishikawa cells represented the EDC-exposed endometrium, while JEG-3 spheroids represented embryos. Since human implantation typically occurs over 72 hours, the assay was conducted for the same duration. The results suggest that DBP affects the endometrium, reducing the outgrowth area of embryos. This experiment provides evidence that DBP negatively impacts early implantation and invasion in humans. In a previous study, TBBPA significantly decreased outgrowth compared to non-exposed controls. Unlike TBBPA, DBP reduced attachment rates at the 10- and 30-minute time points and decreased outgrowth at higher concentrations [34].

Several previous studies have shown that DBP negatively affects implantation in experimental animals. Ema et al. [35] reported that administering DBP to pregnant or pseudo-pregnant rats led to increased pre- and post-implantation losses, as well as reduced uterine decidualization—a critical functional and morphological change necessary for pregnancy. Additionally, another study found that DBP exhibited embryotoxic effects in pregnant Institute of Cancer Research mice, raising concerns about its potential teratogenicity [36]. Furthermore, research on DBP’s reproductive toxicity revealed that exposure resulted in higher implantation loss and smaller litter sizes in pregnant rats and their offspring [37].

This study had several limitations. First, human endometrial adenocarcinoma and choriocarcinoma cell lines were used. Compared to primary cells, cancer cell lines exhibit higher proliferation, adhesion, and differentiation rates, which may have affected the outcomes of the attachment assays. Second, the impact of EDCs on JEG-3 spheroids remains largely unexplored. While EDCs may influence both the endometrium and the embryo during early implantation, in this experiment, DBP exposure was limited to Ishikawa cells. Third, the reproductive toxicity of other phthalates, such as DEHP and DIBP, has yet to be fully elucidated. Further studies using organoid models and in vivo animal experiments are necessary to evaluate the risks associated with inevitable EDC exposure. Finally, the DBP concentrations and exposure durations used in this study may not fully replicate real-world environmental exposure. In natural settings, humans are exposed to low concentrations of EDCs over extended periods. However, maintaining such conditions in cellular experiments remains challenging, limiting the ability to accurately model long-term human exposure.

In conclusion, this study demonstrated that DBP significantly affects early implantation and invasion in a 3D cell culture model through its estrogenic activity, induction of an inflammatory environment, and alterations in mRNA and protein expression. These findings suggest that DBP may negatively impact reproductive processes in humans, emphasizing the need for further research to better understand its potential role in female infertility.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

This paper was supported by Eulji University in 2024 (EJRG-24-09).

Author contributions

Conceptualization: WL, IK. Methodology: WL, IK, JHJ, JL. Formal analysis: WL, IK. Data curation: WM, IK, JHJ, JL. Funding acquisition: JL. Project administration: JL. Writing-original draft: WM, IK. Writing-review & editing: JHJ, JL. Approval of final manuscript: WL, IK, JHJ, JL.

Figure 1.

Outgrowth area of JEG-3 spheroids on dibutyl phthalate (DBP)-treated Ishikawa cells. (A) Measurement of the outgrowth area of JEG-3 spheroids on DBP-treated Ishikawa cells. ImageJ was used to measure the area. (B) Outgrowth area compared to the control group. ^a)p<0.05.

Figure 2.

Experimental design and assessment of dibutyl phthalate (DBP)-induced cell viability in Ishikawa cells. (A) Experimental design and methodology for this study. (B) Cell viability of Ishikawa cells measured using the Cell Counting Kit-8 (CCK-8) assay to assess the cytotoxicity of DBP. Ishikawa cells were treated with DBP for 72 hours.

Figure 3.

mRNA expression of attachment-, estrogen receptor alpha (ERα) signaling-, and inflammation-related genes in Ishikawa cells. (A) mRNA expression of attachment-related genes (integrin alpha V [ITGαV] and leukemia inhibitory factor [LIF]) measured in Ishikawa cells treated with dibutyl phthalate (DBP) for 8 hours. (B) mRNA expression of ERα signaling-related genes (ERα, aryl hydrocarbon receptor [AHR], AHR nuclear translocator [ARNT], and cytochrome P450 family 1 subfamily A member 1 [CYP1A1]) measured in Ishikawa cells treated with DBP for 8 hours. (C) mRNA expression of inflammation-related genes (interleukin 6 [IL-6], IL-1β, and tumor necrosis factor-α [TNF-α]) measured in Ishikawa cells treated with DBP for 8 hours. ^a)p<0.05; ^b)p<0.01; ^c)p<0.001.

Figure 4.

Protein levels of attachment- and inflammation-related genes in Ishikawa cells. (A) Western blot bands showing the results for attachment-related proteins. (B) Relative quantification of attachment-related proteins in dibutyl phthalate (DBP)-treated Ishikawa cells. (C) Western blot bands showing the results for inflammation-related proteins. (D) Relative quantification of inflammation-related proteins in DBP-treated Ishikawa cells. ITGαV, integrin alpha V; LIF, leukemia inhibitory factor; ERα, estrogen receptor alpha; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL-6, interleukin 6; TNF-α, tumor necrosis factor-α. ^a)p<0.05.

Figure 5.

Fluorescence immunocytochemistry of dibutyl phthalate (DBP)-treated Ishikawa cells. (A) Immunocytochemistry in Ishikawa cells using Alexa 488, estrogen receptor alpha (ERα), and 4′,6-diamidino-2-phenylindole (DAPI). ERα signaling and DAPI were merged using ImageJ (National Institutes of Health). (B) Quantification of immunocytochemistry in Ishikawa cells. The intensity of ERα in the nucleus and cytoplasm was measured and calculated using ImageJ, and the corresponding ratios were graphed. E2, estradiol. ^a)p<0.05; ^b)p<0.01.

Figure 6.

Attachment rate of JEG-3 spheroids on dibutyl phthalate (DBP)-treated Ishikawa cells. (A) Morphologies of an Ishikawa cell and a JEG-3 cell spheroid, with the JEG-3 spheroid placed on top of the DBP-treated Ishikawa cell layer. (B) Graph showing attachment rates of spheroids placed on the DBP-treated Ishikawa cell layer. ^a)p<0.05.

Table 1.

Primer sequences used for real-time polymerase chain reaction

Gene	Primer name	Primer sequence (5′-3′)	Amplicon size (bp)
GAPDH	F	GGAGCGAGATCCCTCCAAAA	197
GAPDH	R	GGCTGTTGTCATACTTCTCA	197
LIF	F	CCAACGTGACGGACTTCCC	82
LIF	R	TACACGACTATGCGGTACAG	82
ITGαV	F	AATCTTCCAATTGAGGATATCAC	140
ITGαV	R	AAAACAGCCAGTAGCAACAAT	140
ERα	F	AAGAAAGAACAACATCAGCAG	124
ERα	R	CCTAGCCTCTCATAATTGCTG	124
AHR	F	AGATGAGGAAGGAACAGAGCA	119
AHR	R	GGGATCCATTATGGCAGGAAA	119
ARNT	F	CACAGTGAAATTGAACGGC	208
ARNT	R	CTGATCAGTGAGGAAAGACG	208
CYP1A1	F	AACCTTCCCTGATCCTTGTGAT	148
CYP1A1	R	ATGACAGAGGCCAGAAGAAACT	148
TNF-α	F	CCCGAGTGACAAGCCTGTAG	271
TNF-α	R	GATGGCAGAGAGGAGGTTGAC	271
IL-6	F	ACAGCCACTCACCTCTTCAG	168
IL-6	R	CCATCTTTTTCAGCCATCTTT	168
IL-1β	F	AGATGATAAGCCCACTCTACAG	276
IL-1β	R	ACATTCAGCACAGGACTCTC	276

bp, base pairs/length; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; LIF, leukemia inhibitory factor; ITGαV, integrin alpha V; ERα, estrogen receptor alpha; AHR, aryl hydrocarbon receptor; ARNT, AHR nuclear translocator; CYP1A1, cytochrome P450 family 1 subfamily A member 1; TNF-α, tumor necrosis factor alpha; IL-6, interleukin 6; IL-1β, interleukin 1 beta.

References

1. Mustafa M, Sharifa AM, Hadi J, IIIzam EM, Aliya S. Male and female infertility: causes, and management. IOSR J Dent Med Sci 2019;18:27-32.

2. Obeagu EI, Njar VE, Obeagu GU. Infertility: prevalence and consequences. Int J Curr Res Chem Pharm Sci 2023;10:43-50.

3. Sudha G, Reddy KSN. Causes of female infertility: a cross-sectional study. Int J Latest Res Sci Technol 2013;2:119-23.

4. Van Voorhis BJ. Outcomes from assisted reproductive technology. Obstet Gynecol 2006;107:183-200.

5. Sebastian-Leon P, Garrido N, Remohi J, Pellicer A, Diaz-Gimeno P. Asynchronous and pathological windows of implantation: two causes of recurrent implantation failure. Hum Reprod 2018;33:626-35.

6. Diedrich K, Fauser BC, Devroey P, Griesinger G. The role of the endometrium and embryo in human implantation. Hum Reprod Update 2007;13:365-77.

7. Sharma A, Kumar P. Understanding implantation window, a crucial phenomenon. J Hum Reprod Sci 2012;5:2-6.

8. Annamalai J, Namasivayam V. Endocrine disrupting chemicals in the atmosphere: their effects on humans and wildlife. Environ Int 2015;76:78-97.

9. Diamanti-Kandarakis E, Bourguignon JP, Giudice LC, Hauser R, Prins GS, Soto AM, et al. Endocrine-disrupting chemicals: an Endocrine Society scientific statement. Endocr Rev 2009;30:293-342.

10. Lucas A, Herrmann S, Lucas M. The role of endocrine-disrupting phthalates and bisphenols in cardiometabolic disease: the evidence is mounting. Curr Opin Endocrinol Diabetes Obes 2022;29:87-94.

11. le Maire A, Bourguet W, Balaguer P. A structural view of nuclear hormone receptor: endocrine disruptor interactions. Cell Mol Life Sci 2010;67:1219-37.

12. Wang Y, Qian H. Phthalates and their impacts on human health. Healthcare (Basel) 2021;9:603.

13. Brehm E, Flaws JA. Transgenerational effects of endocrine-disrupting chemicals on male and female reproduction. Endocrinology 2019;160:1421-35.

14. Mlynarcikova AB, Scsukova S. Effect of selected bisphenol derivatives on nuclear receptor expression in ovarian cell line COV434. Endocr Regul 2020;54:275-83.

15. Benjamin S, Masai E, Kamimura N, Takahashi K, Anderson RC, Faisal PA, et al. Phthalates impact human health: Epidemiological evidences and plausible mechanism of action. J Hazard Mater 2017;340:360-83.

16. Wu AH, Franke AA, Wilkens LR, Tseng C, Conroy SM, Li Y, et al. Urinary phthalate exposures and risk of breast cancer: the Multiethnic Cohort study. Breast Cancer Res 2021;23(1):44.

17. Ito Y, Kamijima M, Nakajima T. Di(2-ethylhexyl) phthalate-induced toxicity and peroxisome proliferator-activated receptor alpha: a review. Environ Health Prev Med 2019;24(1):47.

18. Sun F, Tao Y, Shi D, Yang J, Li H, Wei Y, et al. Ecological risk assessment of phthalate esters (DBP and DEHP) in surface water of China. Front Environ Sci 2021;9:710125.

19. Xiong Z, Zeng Y, Zhou J, Shu R, Xie X, Fu Z, et al. Exposure to dibutyl phthalate impairs lipid metabolism and causes inflammation via disturbing microbiota-related gut-liver axis. Acta Biochim Biophys Sin (Shanghai) 2020;52:1382-93.

20. Gonzalez-Marquez A, Volke-Sepulveda T, Diaz R, Sanchez C. Enhanced esterase activity during the degradation of dibutyl phthalate by Fusarium species in liquid fermentation. J Ind Microbiol Biotechnol 2021;48:kuab062.

21. Zhang C, Li S, Tang L, Li S, Hu C, Zhang D, et al. Ultrasensitive, label-free voltammetric detection of dibutyl phthalate based on poly-l-lysine/poly(3,4-ethylenedioxythiophene)-porous graphene nanocomposite and molecularly imprinted polymers. Biosensors (Basel) 2024;14:121.

22. Panagiotou EM, Ojasalo V, Damdimopoulou P. Phthalates, ovarian function and fertility in adulthood. Best Pract Res Clin Endocrinol Metab 2021;35:101552.

23. Shuto T, Horie H, Hikawa N, Sango K, Tokashiki A, Murata H, et al. IL-6 up-regulates CNTF mRNA expression and enhances neurite regeneration. Neuroreport 2001;12:1081-5.

24. Vandenberg LN, Colborn T, Hayes TB, Heindel JJ, Jacobs DR, Lee DH, et al. Hormones and endocrine-disrupting chemicals: low-dose effects and nonmonotonic dose responses. Endocr Rev 2012;33:378-455.

25. Heshmati HM. Human health consequences of endocrine-disrupting chemicals. In: Sarvajayakesavalu S, Charoensudjai P, editors. Environmental issues and sustainable development. IntechOpen; 2021 [cited 2025 Jul 17]. Available from: https://www.intechopen.com/books/9664

26. Guan G, Su H, Wei X, Zheng Y, Jin X. The promotion of tetrabromobisphenol A exposure on Ishikawa cells proliferation and pivotal role of ubiquitin-mediated IκB' degradation. Ecotoxicol Environ Saf 2021;207:111254.

27. Fukui Y, Hirota Y, Saito-Fujita T, Aikawa S, Hiraoka T, Kaku T, et al. Uterine epithelial LIF receptors contribute to implantation chamber formation in blastocyst attachment. Endocrinology 2021;162:bqab169.

28. Simón C, Moreno C, Remohi J, Pellicer A. Molecular interactions between embryo and uterus in the adhesion phase of human implantation. Hum Reprod 1998;13 Suppl 3:219-36.

29. Suman P, Malhotra SS, Gupta SK. LIF-STAT signaling and trophoblast biology. JAKSTAT 2013;2:e25155.

30. Cheng X, Chen J, Guo X, Cao H, Zhang C, Hu G, et al. Disrupting the gut microbiota/metabolites axis by di-(2-ethylhexyl) phthalate drives intestinal inflammation via AhR/NF-κB pathway in mice. Environ Pollut 2024;343:123232.

31. Zhou B, Wang X, Li F, Wang Y, Yang L, Zhen X, et al. Mitochondrial activity and oxidative stress functions are influenced by the activation of AhR-induced CYP1A1 overexpression in cardiomyocytes. Mol Med Rep 2017;16:174-80.

32. Al-Dhfyan A, Alhoshani A, Korashy HM. Aryl hydrocarbon receptor/cytochrome P450 1A1 pathway mediates breast cancer stem cells expansion through PTEN inhibition and β-catenin and Akt activation. Mol Cancer 2017;16:14.

33. Lai KP, Wong MH, Wong CK. Modulation of AhR-mediated CYP1A1 mRNA and EROD activities by 17beta-estradiol and dexamethasone in TCDD-induced H411E cells. Toxicol Sci 2004;78:41-9.

34. Koo M, Kang I, Jun JH, Lee J. Effect of tetrabromobisphenol A (TBBPA) on early implantation using the three-dimensional spheroid model with human endometrial cell line, Ishikawa. Environ Sci Eur 2023;35:69.

35. Ema M, Miyawaki E, Kawashima K. Effects of dibutyl phthalate on reproductive function in pregnant and pseudopregnant rats. Reprod Toxicol 2000;14:13-9.

36. Shiota K, Nishimura H. Teratogenicity of di(2-ethylhexyl) phthalate (DEHP) and di-n-butyl phthalate (DBP) in mice. Environ Health Perspect 1982;45:65-70.

37. Heidari T, Batavani RA, Malekinejad H, Hobbenaghi R. Evaluation of di-n-butyl phthalate reproductive toxicity in pregnant rats and their offspring and assessment of vitamin E administration in reducing toxicity. Vet Res Forum 2022;13:201-8.