Protective effects of Origanum vulgare L. leaf aqueous extract on spermatogenesis in testopathy induced by cisplatin chemotherapy: An experimental study

Article information

Korean J Fertil Steril. 2025;.cerm.2025.07920
Publication date (electronic) : 2025 December 24
doi : https://doi.org/10.5653/cerm.2025.07920
1Department of Basic Science, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
2Department of Operating Room, Nahavand School of Allied Medical Sciences, Hamadan University of Medical Sciences, Hamadan, Iran
Corresponding author: Hassan Morovvati Department of Basic Science, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran Tel: +989166182384 E-mail: hmorovvati@ut.ac.ir
Received 2025 February 25; Revised 2025 May 28; Accepted 2025 June 19.

Abstract

Objective

Cisplatin, a widely used chemotherapy agent, is known to induce testopathy and degeneration of the germinal epithelium (GE). Origanum vulgare L. (OV) leaf extract, due to its antioxidative properties, may alleviate such cellular damage. This experimental study was conducted to evaluate the protective and therapeutic effects of OV against cisplatin-induced testopathy.

Methods

Forty-eight male Naval Medical Research Institute mice were assigned to six groups. Testopathy was induced via intraperitoneal injection of cisplatin (single dose, 1 mg/kg on day 0). OV was administered as treatment (400 mg/kg orally, 5 days per week, for 5 weeks). Phytochemical screening of OV was also performed. After the experimental period, the animals were euthanized, and both blood serum and testicular samples were collected. Total body weight and total testicular weight were measured. Histopathological examination using hematoxylin and eosin staining (to assess the gonadosomatic index [GSI]) and immunohistochemical (IHC) detection of 3β-hydroxysteroid dehydrogenase (3β-HSD) protein were conducted. Expression levels of the p53 and B-cell lymphoma 2 (Bcl-2) genes, as well as serum testosterone levels, were evaluated. Statistical analysis was performed with SPSS ver.16, and significance was set at p<0.05.

Results

A phytochemical analysis of OV confirmed the presence of antioxidant compounds. Cisplatin administration resulted in significant detrimental alterations in testicular tissue (p<0.05). In animals receiving OV following cisplatin exposure, the GSI, testosterone levels, histological parameters, and total testicular weight improved toward physiological values (p<0.05). Additionally, IHC staining for 3β-HSD protein indicated regeneration of Leydig cells. Gene expression analysis showed down-regulation2 of p53 and up-regulation of Bcl-2 (p<0.05).

Conclusion

OV administration, owing to its antioxidative characteristics, shows promise as a protective phytomedicine against cisplatin-induced testopathy. OV promotes GE proliferation, enhances testosterone secretion, and modulates the expression of apoptotic genes.

Introduction

The histological architecture of the testes is highly specialized for spermatogenesis. Each testis is surrounded by a dense connective tissue layer called the tunica albuginea. Within the testes, seminiferous tubules are lined with stratified germinal epithelium composed of Sertoli cells and various stages of germ cells. The interstitial connective tissue contains Leydig cells, which are responsible for synthesizing testosterone. Testopathy refers to pathological changes that disrupt the process of spermatogenesis. If left untreated, testopathy may ultimately lead to infertility. Histopathological evaluation reveals significant alterations, such as tubule atrophy and degeneration of the germinal epithelium, which are associated with decreased sperm counts and motility [1]. Cisplatin is a potent chemotherapeutic agent widely used for treating multiple types of cancer, including testicular, ovarian, lung, and bladder malignancies [2]. Its cytotoxic action primarily involves the formation of DNA cross-links and the disruption of both DNA replication and transcription, culminating in apoptosis. Although cisplatin is clinically effective, it is also associated with numerous adverse effects, including testopathy [3]. Origanum vulgare L. (OV), commonly known as oregano, is a perennial herb recognized for its robust antioxidant capacity, attributed mainly to its high levels of phenolic compounds. These constituents efficiently neutralize free radicals and reduce oxidative stress, which is implicated in a range of diseases, including cancer and cardiovascular disorders [4]. OV extract has demonstrated protective effects on cellular structures by mitigating oxidative damage and bolstering the body's antioxidant defenses. The ability of OV to restore elevated levels of antioxidant enzymes further supports its therapeutic potential as a natural supplement for ameliorating oxidative stress-related pathologies. Thus, OV represents a promising candidate for development in nutraceutical and pharmaceutical applications [5].

As previously described, the use of natural compounds with antioxidative properties, in conjunction with conventional therapies, has the potential to counteract drug-induced adverse effects and promote tissue regeneration. Accordingly, this experimental study was designed to investigate the protective and therapeutic effects of OV on testopathy induced by cisplatin administration in Naval Medical Research Institute (NMRI) mice.

Methods

1. Ethical considerations

This experimental study was conducted at Tehran University of Medical Sciences (Tehran, Iran). All procedures were performed under the supervision of the Ethics Committee of Tehran University (Ethics Code: IR.UT.VETMED.REC.1403.009). Animal handling and experimentation were conducted in accordance with the ethical principles outlined in the Declaration of Helsinki (1975, revised 2000) [6].

2. Animal grouping and procedures

In this study, 48 male NMRI mice (n=8 per group, aged 8–12 weeks, approximately 25 g) were used. The animals were allocated into six distinct groups: (1) control (0.2 mL normal saline [N/S] delivered intraperitoneally [IP] followed by 5 weeks of oral N/S); (2) cisplatin 1 (a single IP dose of cisplatin followed by euthanasia on day 8); (3) cisplatin 2 (a single IP dose of cisplatin followed by euthanasia on day 35); (4) OV (5 weeks of oral OV administration); (5) cisplatin+OV1 (a single IP injection of cisplatin followed by 5 weeks of oral OV beginning on day 0); and (6) cisplatin+OV2 (a single IP injection of cisplatin followed by 5 weeks of oral OV beginning on day 8). Cisplatin (1 mg/kg) was administered via IP injection in a standard volume of 0.2 mL OV was administered orally at 400 mg/kg, 5 days per week for 5 weeks. Euthanasia was performed on days 0 and 8 for the cisplatin 1 and cisplatin 2 groups, respectively. The cisplatin+OV1 and cisplatin+OV2 groups were designed to evaluate the protective and therapeutic effects of OV, respectively.

3. OV leaf aqueous extraction and dosage

For the preparation of OV aqueous extract, 100 g of powdered OV leaves were combined with 1 L of distilled water at a ratio of 1:5 to 1:10 (w/v). The mixture was boiled at 60 °C for 2 hours, then centrifuged twice at 1,500 rpm for 15 minutes. The supernatant was filtered using Whatman filter paper to separate the liquid extract from solid residues. The filtrate was incubated at 37 °C for 7 days, after which the sediments (main extract) were collected for treatment. The effective dose was set at 400 mg/kg for 5 weeks (5 days per week), according to the protocol of Chen et al. [7].

4. Semi-quantitative phytochemical screening of OV

Semi-quantitative phytochemical screening was performed to systematically extract and analyze plant material, thereby identifying and quantifying phytochemicals. The prepared OV extract underwent colorimetric assays and precipitation tests to detect alkaloids, flavonoids, tannins, saponins, and terpenes. Flavonoids were identified by adding 1% aluminum chloride solution, resulting in a color change. Saponins were detected by vigorous shaking with distilled water; persistent foam indicated a positive result. Each phytochemical was evaluated using a standard scale (low, moderate, high) to semi-quantitatively assess abundance. This approach provided insight into the presence of bioactive compounds and their potential therapeutic value [8].

5. Testopathy induction using IP injection of cisplatin

Testopathy was induced by preparing a stock solution of cisplatin and calculating the appropriate dosage based on body weight. The anterior abdominal wall was shaved and disinfected with 70% ethanol. Cisplatin (1 mg/kg) was injected intraperitoneally using an insulin syringe to induce testopathy [9].

6. OV oral administration and protective/therapeutic procedures

After cisplatin injection (day 0), testopathy was induced by day 8. OV was administered either as a protective measure (cisplatin+OV1 group, starting day 0) or as a therapeutic intervention (cisplatin+OV2 group, starting day 8). All OV treatments were delivered orally (dissolved in 0.2 mL of N/S), 5 days per week for 5 weeks.

7. Tissue sampling protocols

One day after the final treatment, animals were anesthetized using intramuscular ketamine/xylazine (50 IU), followed by euthanasia via cervical dislocation. Thoracotomy was performed, and blood was collected by cardiac puncture (2 mL) for enzyme-linked immunosorbent analysis enzyme-linked immunosorbent assay (ELISA) analysis of testosterone levels. Testes were excised for histopathological evaluation (hematoxylin and eosin [HE] and immunohistochemistry [IHC], right testis) and gene expression analysis of p53 and B-cell lymphoma 2 (Bcl-2; left testis). Total body weight (prior to tissue excision) and total testicular weight (after excision) were recorded [10].

8. Histopathological assessment using HE staining

Excised right testes were fixed in 10% formalin for 2 weeks. Samples were then processed for dehydration, clearing, and paraffin embedding. Thin sections (5 μm) were cut and mounted on slides, followed by HE staining according to previously published protocols [11]. Finally, histopathological assessment was applied using a microscope at 400× magnification.

9. IHC localization of 3β-hydroxysteroid dehydrogenase

3β-Hydroxysteroid dehydrogenase (3β-HSD) is a key enzyme in the biosynthesis of steroid hormones such as testosterone. Histological sections were incubated in methanol with 3% H2O2. Antigen retrieval was performed using sodium citrate buffer (pH 6, 10 mM, 98 °C, 15 minutes). Slides were incubated at 4 °C with a mouse monoclonal antibody against 3β-HSD as the primary antibody. After overnight incubation, sections were treated with biotinylated goat anti-mouse immunoglobulin G (IgG), then exposed to 3,3-diaminobenzidine substrate (chromogen) for 8 minutes. Positive antibody binding appeared as brown staining [12].

10. p53 and Bcl-2 gene expression using quantitative polymerase chain reaction

Tissue samples were homogenized, and RNA was extracted (RNA extraction kit, RNX-PLUS solution, CAT NO: EX6101; SinaClon Co.). RNA quality was checked by Nanodrop spectrophotometry (Synergy H1; Biotek) at 260 nm, and integrity was verified on 1% agarose gel. Purified RNA was used to synthesize cDNA (First Strand cDNA synthesis kit, CAT NO: RT5201; SinaClon Co.). Quantitative polymerase chain reaction was conducted (SyberBlue; SinaClon Co.) using specific primers for leukemia inhibitory factor, p53 (F: CCCCTCCATCCTTTCTTCTC, R: ATGAGCCAGATCAGGGACTG) [13], Bcl-2 (F; GCCGAGGAGGATGATTGAC, R; CCTCAGCCTCCGTTTCTTG), and actin beta (ACTB) [14] (F; TGACCCAGATCATGTTTGAGACC, R; CTCGTAGATGGGCACAGTGTGGG) [15] was considered as the internal control. Data were represented as the fold change and analyzed using the 2-ΔΔct method.

11. Assessment of serum testosterone levels using ELISA

Serum testosterone levels were measured using an ELISA kit (Diaclone Co., CAT NO: 950.090.096; PadGin Teb Co.). Standard solutions were prepared according to kit instructions. Testosterone concentrations were measured using an ELISA reader (NanoDrop Spectrophotometer, EPOCH Model; BioTek Co., Gen5 software) at 450 nm. The standard curve was generated, and cytokine concentrations were determined. Data are presented as ng/mL [16].

12. Statistical analysis

The normality of data distribution was assessed using the Kolmogorov-Smirnov test. Significant differences among groups were evaluated using the unpaired t-test and analysis of variance. Results are reported as mean±standard error of the mean, and p-values <0.05 were considered statistically significant. All analyses were performed using SPSS software ver. 16 (SPSS Inc.), and graphs were generated using GraphPad Prism software ver. 9 (GraphPad).

Results

1. Semi-quantitative phytochemical screening of OV

Phytochemical analysis revealed that the OV extract was rich in 9-octadecenoic acid, methyl ester, dodecanoic acid, saponins, and tannins. In addition, other phytochemicals such as flavonoids, phlobatannins, and anthraquinones were identified. The presence of these compounds confirmed the strong antioxidant properties of OV, supporting its potential for the treatment of cisplatin-induced testopathy.

2. Alteration of testicular and total body weight following OV prescription in cisplatin-induced testopathy

Total body weight (Figure 1A) and total testicular weight (Figure 1B) were recorded at the end of the experiment, just prior to tissue sampling. No significant (p>0.05) differences in total body weight were observed among the groups. However, significant (p<0.05) differences in total testicular weight were found. After induction of testopathy, total testicular weight was significantly reduced (p<0.05) in the cisplatin 1 and cisplatin 2 groups compared to controls. In contrast, total testicular weight increased significantly (p<0.05) following OV administration in the cisplatin+OV1 group compared to the cisplatin 2 group. No additional significant changes were observed among the remaining groups. These results indicate that cisplatin can induce testicular damage, while oral administration of OV as a protective agent supports germinal epithelium regeneration in the cisplatin+OV1 group.

Figure 1.

Total body weight and total testicular weight alterations in treatment groups. Values are presented as mean±standard deviation (n=8 male MNRI mice in each group). C, control; Cis, cisplatin; OV, Origanum vulgare L. a)Significant changes compared to the C group; b)Significant changes compared to the Cis2 group.

3. Alteration of the gonadosomatic index following OV prescription in cisplatin-induced testopathy

No significant (p>0.05) changes were found in tunica albuginea thickness across all groups. Induction of testopathy with cisplatin led to significant (p<0.05) reductions in seminiferous tubule diameter, germinal epithelium height, Leydig cell count, Sertoli cell count, spermatocyte count, and interstitial connective tissue aggregation in the cisplatin 1 and cisplatin 2 groups compared to controls. Degenerated germinal epithelium was also significantly increased (p<0.05) in these groups. After OV administration (in cisplatin+ov1 and cisplatin+OV2 groups), significant improvements (p<0.05) were observed in seminiferous tubule diameter, germinal epithelium height, Leydig cell count, Sertoli cell count, spermatocyte count, and interstitial tissue aggregation compared to the cisplatin 2 group, along with a significant reduction (p<0.05) in degenerated seminiferous tubules. Other groups exhibited non-significant changes (p>0.05) (Table 1).

Statistical analysis of the gonadosomatic index and testosterone in various treatment groups

4. Alteration of serum levels of testosterone following OV prescription in cisplatin-induced testopathy

After cisplatin administration and induction of testopathy, serum testosterone levels were significantly decreased (p<0.05) in the cisplatin 1 and cisplatin 2 groups compared to controls. OV administration (in cisplatin+OV1 and cisplatin+OV2 groups) significantly increased serum testosterone levels (p<0.05) relative to the cisplatin 2 group (Table 1). This rise in testosterone was associated with regeneration of Leydig cell aggregation in the interstitial connective tissue, as confirmed by IHC staining for 3β-HSD.

5. Alteration of histopathological features (HE staining) following OV prescription in cisplatin-induced testopathy

After cisplatin administration (in the cisplatin 1 and cisplatin 2 groups) and testopathy induction, substantial detrimental changes were observed in testicular histopathology. The interstitial connective tissue was markedly degenerated, and Leydig cell aggregation was visibly reduced. Microscopic analysis of the seminiferous tubules revealed a disorganized arrangement of spermatogenic cell lines, with notable gaps between Sertoli cells and fragmentation of spermatogenic architecture, resulting in a lower density of spermatogenic cells compared to controls. Following OV treatment, a more organized cellular arrangement was observed in the cisplatin+OV groups compared to the cisplatin-only groups. In these groups, interstitial connective tissue and Leydig cell aggregation were enhanced. Microscopically, the germinal epithelium appeared regenerated and compacted, with fewer cellular gaps and improved Sertoli cell organization, ultimately resulting in higher densities of spermatogenic cells (Figure 2). These histopathological changes demonstrate the protective effects of OV administration against cisplatin-induced testopathy.

Figure 2.

Histopathological changes of testicular tissue stained with hematoxylin and eosin (400×) (n=8 male Naval Medical Research Institute mice in each group). (A) Control (C) group, (B) cisplatin group (Cis1), (C) cisplatin group (Cis2), (D) Origanum vulgare L. (OV) group, (E) Cis+OV1 group, and (F) Cis+OV2 group.

6. Alteration of IHC features against 3β-HSD following OV prescription in cisplatin-induced testopathy

A lower concentration of 3β-HSD was visually detected in the cisplatin 1 and cisplatin 2 groups compared to controls. Following OV administration (in cisplatin+OV1 and cisplatin+OV2 groups), a marked increase in staining intensity for 3β-HSD was observed relative to the cisplatin 2 group. This suggests that cisplatin administration reduced 3β-HSD protein expression, while subsequent OV treatment promoted Leydig cell regeneration, as evidenced by increased 3β-HSD levels, and thereby supported testosterone production in cisplatin-treated mice (Figure 3).

Figure 3.

Immunohistopathological changes in testicular tissue stained against 3β-hydroxysteroid dehydrogenase (3β-HSD) protein in Leydig cells (400×) (n=8 male Naval Medical Research Institute mice in each group). Yellow arrows indicate the expression of the 3β-HSD enzyme. (A) Control (C) group, (B) cisplatin group (Cis1), (C) cisplatin group (Cis2), (D) Origanum vulgare L. (OV) group, (E) Cis+OV1 group, and (F) Cis+OV2 group.

7. Alteration of apoptotic gene expression following OV prescription in Cis-induced testopathy

The genes p53 (Figure 4A) and Bcl-2 (Figure 4B) represent key apoptotic and anti-apoptotic regulators in testicular cells. Cisplatin administration resulted in significant (p<0.05) up-regulation of p53 gene expression in the cisplatin 1 and cisplatin 2 groups compared to controls. Moreover, p53 expression was significantly higher in the cisplatin 1 group than in the cisplatin 2 group (p<0.05). In the cisplatin+OV1 and cisplatin+OV2 groups, p53 expression was significantly downregulated compared to the cisplatin 2 group (p<0.05). Regarding Bcl-2, cisplatin administration (in the cisplatin 1 and cisplatin 2 groups) significantly downregulated Bcl-2 expression compared to controls (p<0.05), with a significant increase in Bcl-2 expression in the cisplatin 2 group relative to the cisplatin 1 group (p<0.05). Following OV administration, Bcl-2 expression was significantly upregulated in both the cisplatin+OV1 and cisplatin+OV2 groups compared to the cisplatin 2 group (p<0.05). These genetic findings indicate the pro-apoptotic effects of cisplatin and the anti-apoptotic protective properties of OV.

Figure 4.

Gene expression (fold change) of (A) p53 and (B) B-cell lymphoma 2 (Bcl-2) in treatment groups. Values are presented as mean±standard deviation (n=8 male MNRI mice in each group). C, control; Cis, cisplatin; OV, Origanum vulgare L. a)Significant changes compared to the C group; b)Significant changes compared to the Cis1 group; c)Significant changes compared to the Cis2 group.

Discussion

The present experimental study was designed to assess the effects of OV, known for its antioxidative properties, on the mitigation of testopathy induced by cisplatin administration. As demonstrated by the findings, co-administration of OV alongside cisplatin led to positive histological changes and suppression of apoptosis in germinal epithelium cells. These improvements increased the gonadosomatic index (GSI) and enhanced sperm production. Moreover, extensive regeneration was observed in interstitial tissues, including Leydig cells, resulting in the normalization and restoration of serum testosterone levels. These results support a prominent protective role for OV, suggesting that its use alongside cisplatin chemotherapy may help preserve testicular architecture and reduce tissue damage associated with cisplatin.

Phytomedicine, the therapeutic application of plant-derived substances, occupies a vital place in modern medicine due to its broad pharmacological activity and generally lower side-effect profile compared to synthetic drugs. Phytomedicines exhibit a wide spectrum of biological effects—including anti-inflammatory, antioxidant, and immunomodulatory activities—enabling valuable management of numerous health conditions [13]. Multiple studies have demonstrated that herbal medicines can enhance the therapeutic outcomes of conventional cancer treatments by bolstering the immune response [17]. In addition, phytomedicines are increasingly incorporated into regenerative medicine strategies. The growing body of evidence supporting the safety and efficacy of phytomedicines highlights their potential as complementary therapies, underscoring the need for further research and the standardization of their clinical application. OV, commonly referred to as oregano, has been investigated for its potential protective effects against cisplatin-induced testopathy in male mice. Cisplatin is well-known for causing substantial oxidative stress and apoptosis in testicular tissue, leading to impaired spermatogenesis and fertility disturbances. The bioactive compounds in OV possess significant antioxidant properties, which can mitigate oxidative damage by scavenging free radicals and boosting the activity of endogenous antioxidant enzymes [18]. Studies indicate that OV extract administration can substantially reduce markers of oxidative stress and apoptosis in testicular tissue, thereby preserving testicular structure and function. OV also modulates inflammatory responses and enhances steroidogenic activity, further supporting its therapeutic value in counteracting cisplatin-induced testicular toxicity. These features make OV a promising candidate as an adjunct therapy for male cancer patients undergoing cisplatin treatment [19]. The protective properties of OV have been extensively examined in models of oxidative stress and tissue injury, particularly with regard to its capacity to counteract the deleterious effects of toxic agents such as cisplatin and paraquat. For example, Sharifi-Rigi et al. [20] demonstrated that hydroalcoholic leaf extract of OV significantly reduced oxidative stress and inflammatory markers, such as TNF-α, while ameliorating histological liver damage in paraquat-induced hepatotoxicity in rats. This study underscores the herb’s potent antioxidant and anti-inflammatory properties, which are critical for protection against cellular damage driven by reactive oxygen species [20]. Complementarily, Chen et al. [7] evaluated OV’s protective effects in a model of finasteride-induced testicular and sperm damage, showing that the extract alleviated oxidative stress and apoptosis in testicular tissues—further corroborating the notion that OV’s antioxidant capacity underpins its protective efficacy. These results are consistent with those of Sun et al., [21] who found that OV leaf extract mitigated oxidative stress in mouse liver and kidney tissues, strengthening the evidence for its function as a powerful antioxidant agent. Collectively, these studies emphasize that OV’s protective effects are likely mediated by its rich content of phenolic compounds and flavonoids, which bolster the antioxidant defense system and neutralize free radicals. Both Chen et al. [7] and Sun et al. [21] reported marked improvements in biochemical markers of oxidative stress following OV extract treatment, suggesting a dose-dependent relationship between administration and efficacy. In contrast, Ozkalp et al. [22] focused on the antibacterial activity of OV essential oil, underscoring the broader pharmacological applications of OV beyond oxidative stress modulation. Similarly, Mombeini et al. [23] explored OV’s neuroprotective and anxiolytic potential, further expanding the herb’s therapeutic scope. Overall, these findings converge on the conclusion that OV is a promising candidate for therapeutic intervention in oxidative stress-related pathologies, especially those induced by chemotherapeutic agents like cisplatin and environmental toxins such as paraquat. Future research should further elucidate the precise mechanisms underlying OV’s protective effects and explore its clinical application in the prevention and treatment of drug-induced toxicity.

The promising protective effects of OV leaf aqueous extract on spermatogenesis, as demonstrated in experimental models of cisplatin-induced testopathy, suggest considerable potential for its therapeutic application in clinical settings. To translate these findings into patient care, several critical factors must be considered, including optimal dosage, administration route, safety, and efficacy monitoring. First, the dosage of OV extract must be carefully calibrated based on preclinical data, with initial human doses established through rigorous pharmacokinetic and toxicological studies. While the experimental study utilized specific concentrations of the aqueous extract, clinical trials should aim to identify an effective and safe dose range that can preserve or restore spermatogenesis without adverse effects. Oral administration is likely the most feasible route, considering the traditional use of OV and the extract’s aqueous form; nevertheless, clinical studies must assess bioavailability and absorption rates to optimize therapeutic delivery. Second, the timing and duration of OV treatment in relation to cisplatin chemotherapy cycles are of particular importance. OV administration could be considered as a complementary therapy, initiated prior to or concurrently with cisplatin treatment, to help mitigate testicular damage. Continuous administration throughout chemotherapy, and possibly during a post-treatment recovery period, may enhance restoration of spermatogenesis. Close monitoring of sperm parameters, hormonal profiles (including testosterone), and testicular function will be essential to assess therapeutic response and guide treatment adjustments. Furthermore, the safety profile of OV must be rigorously evaluated, particularly regarding potential interactions between OV’s bioactive compounds and chemotherapeutic agents. Comprehensive clinical trials should therefore include assessments of systemic toxicity, immunological effects, and potential interference with the antitumor efficacy of cisplatin. For further investigation, it is strongly recommended to assess the impact of OV on sperm parameters following the induction of testopathy by cisplatin. Although the present experiment demonstrated the ability of OV to alleviate testopathy, future studies should address the production and function of normal spermatozoa in this context to comprehensively evaluate the therapeutic efficacy of OV.

In summary, OV leaf extract contains multiple bioactive substances with potent antioxidative properties. In this study, administration of OV following cisplatin-induced testopathy was associated with normalization of several pathological parameters, including improvements in GSI, testosterone levels, and histopathological features. Ultimately, sperm production returned to histologically normal levels. These findings suggest that OV is especially effective as a protective agent, supporting its use as an adjunct treatment initiated alongside chemotherapy.

For future research, it is strongly advised to evaluate the effects of OV on sperm parameters after testopathy induction with cisplatin. Given that the present study focused on the mitigation of testopathy, confirming the restoration and function of normal spermatozoa will be crucial to fully establish OV’s therapeutic efficacy in this context.

Notes

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

All authors are grateful to the Research Council of Tehran University for the financial and technical support (Grant No: 30029/6/29).

Author contributions

Conceptualization: HM, AA. Methodology: MDA, AA. Formal analysis: MDA, AA. Data curation: HM, AA. Funding acquisition: HM. Project administration: MDA, AA. Visualization: MDA, AA. Software: MDA, AA. Validation: HM, Investigation: MDA, AA. Supervision: HM, AA. Writing-original draft: MDA. Writing-review & editing: HM, AA. Approval of final manuscript: MDA, HM, AA.

References

1. Yamashita S, Koyama J, Goto T, Fujii S, Yamada S, Kawasaki Y, et al. Trends in age and histology of testicular cancer from 1980-2019: a single-center study. Tohoku J Exp Med 2020;252:219–24. 10.1620/tjem.252.219. 33148936.
2. Ranasinghe R, Mathai ML, Zulli A. Cisplatin for cancer therapy and overcoming chemoresistance. Heliyon 2022;8e10608. 10.1016/j.heliyon.2022.e10608. 36158077.
3. Dasari S, Njiki S, Mbemi A, Yedjou CG, Tchounwou PB. Pharmacological effects of cisplatin combination with natural products in cancer chemotherapy. Int J Mol Sci 2022;23:1532. 10.3390/ijms23031532. 35163459.
4. Emire Z, Yabalak E. Can Origanum be a hope for cancer treatment?: a review on the potential of Origanum species in preventing and treating cancers. Int J Environ Health Res 2023;33:894–910. 10.1080/09603123.2022.2064437. 35414316.
5. Jafari Khorsand G, Morshedloo MR, Mumivand H, Emami Bistgani Z, Maggi F, Khademi A. Natural diversity in phenolic components and antioxidant properties of oregano (Origanum vulgare L.) accessions, grown under the same conditions. Sci Rep 2022;12:5813. 10.1038/s41598-022-09742-4. 35388099.
6. Carlson RV, Boyd KM, Webb DJ. The revision of the Declaration of Helsinki: past, present and future. Br J Clin Pharmacol 2004;57:695–713. 10.1111/j.1365-2125.2004.02103.x. 15151515.
7. Chen X, Feng H, El-Kott AF, Abd-Ella EM. Origanum vulgare L. leaves extract alleviates testis and sperm damages induced by finasteride: biochemical, immunohistological and apoptosis genes based evidences. Andrologia 2020;52e13823. 10.1111/and.13823. 32966695.
8. Salahshoor MR, Abdolmaleki A, Faramarzi A, Jalili C, Shiva R. Does Tribulus terrestris improve toxic effect of Malathion on male reproductive parameters? J Pharm Bioallied Sci 2020;12:183–91. 10.4103/jpbs.jpbs_224_19. 32742118.
9. Ghanbari A, Jalili C, Abdolmaleki A, Shokri V. Effects of cisplatin and acacetin on total antioxidant status, apoptosis and expression of OCTN3 in mouse testis. Biotech Histochem 2022;97:185–91. 10.1080/10520295.2021.1925347. 33998937.
10. Roshankhah S, Abdolmaleki A, Salahshoor MR. Anti-inflammatory, anti-apoptotic, and antioxidant actions of Middle Eastern Phoenix dactylifera extract on mercury-induced hepatotoxicity in vivo. Mol Biol Rep 2020;47:6053–65. 10.1007/s11033-020-05680-4. 32737827.
11. Salahshoor MR, Abdolmaleki A, Jalili C, Roshankhah S, Ziapour A. Determination of histopathological and biomedical parameters in protective effects of Petroselinum crispum on hepatotoxicity induced by dichlorvos in male Wistar rats. Comp Clin Pathol 2020;29:501–9. 10.1007/s00580-019-03087-7.
12. Dumont M, Luu-The V, Dupont E, Pelletier G, Labrie F. Characterization, expression, and immunohistochemical localization of 3 beta-hydroxysteroid dehydrogenase/delta 5-delta 4 isomerase in human skin. J Invest Dermatol 1992;99:415–21. 10.1111/1523-1747.ep12616131. 1401999.
13. Salahshoor MR, Abdolmaleki A, Shabanizadeh A, Jalali A, Roshankhah S. Ipomoea aquatica extract reduces hepatotoxicity by antioxidative properties following dichlorvos administration in rats. Chin J Physiol 2020;63:77–84. 10.4103/cjp.cjp_89_19. 32341233.
14. Mauny MP, Danarto R, Heriyanto DS. Role of methylprednisolone on mRNA expression of BAX, BCL-2 genein testicular torsion-detorsion of male albino Wistar rats. J Med Sci (Berkala Ilmu Kedokteran) 2020;52:205–13. 10.19106/jmedsci005203202002.
15. Gu Y, Tang S, Wang Z, Cai L, Lian H, Shen Y, et al. A pan-cancer analysis of the prognostic and immunological role of β-actin (ACTB) in human cancers. Bioengineered 2021;12:6166–85. 10.1080/21655979.2021.1973220. 34486492.
16. Torabi F, Ahmadi R. The effect of exercise volume on depressive-related behaviors and levels of brain-derived neurotrophic factor and serum testosterone levels. Int J Sport Stud Health 2024;7:56–61. 10.61838/kman.intjssh.7.3.8.
17. Gu X, Hao D, Xiao P. Research progress of Chinese herbal medicine compounds and their bioactivities: Fruitful 2020. Chin Herb Med 2022;14:171–86. 10.1016/j.chmed.2022.03.004. 36117669.
18. Roshankhah S, Abdolmaleki A, Jalili C, Salahshoor MR. Crocin reduces oxidative stress produced by busulfan administration on fertility of male rats. J Adv Med Biomed Res 2019;27:25–33. 10.30699/jambs.27.125.25.
19. Coffetti G, Moraschi M, Facchetti G, Rimoldi I. The challenging treatment of cisplatin-resistant tumors: state of the art and future perspectives. Molecules 2023;28:3407. 10.3390/molecules28083407. 37110640.
20. Sharifi-Rigi A, Heidarian E, Amini SA. Protective and anti-inflammatory effects of hydroalcoholic leaf extract of Origanum vulgare on oxidative stress, TNF-α gene expression and liver histological changes in paraquat-induced hepatotoxicity in rats. Arch Physiol Biochem 2019;125:56–63. 10.1080/13813455.2018.1437186. 29425067.
21. Sun QF, Chen SX, Tang ZF, Song XY, Jing F, Wu HT, et al. Origanum vulgare L. leaf extract alleviates finasteride-induced oxidative stress in mouse liver and kidney. Asian Pac J Trop Biomed 2021;11:194–204. 10.4103/2221-1691.311755.
22. Ozkalp B, Sevgi F, Ozcan M, Ozcan MM. The antibacterial activity of essential oil of oregano (Origanum vulgare L.). J Food Agric Environ 2010;8:272–4.
23. Mombeini T, Mazloumi S, Shams J. Pharmacological effects of Origanum vulgare L. in the elevated plus-maze and open field tests in the rat. J Basic Clin Pathophysiol 2015;3:29–36.

Article information Continued

Figure 1.

Total body weight and total testicular weight alterations in treatment groups. Values are presented as mean±standard deviation (n=8 male MNRI mice in each group). C, control; Cis, cisplatin; OV, Origanum vulgare L. a)Significant changes compared to the C group; b)Significant changes compared to the Cis2 group.

Figure 2.

Histopathological changes of testicular tissue stained with hematoxylin and eosin (400×) (n=8 male Naval Medical Research Institute mice in each group). (A) Control (C) group, (B) cisplatin group (Cis1), (C) cisplatin group (Cis2), (D) Origanum vulgare L. (OV) group, (E) Cis+OV1 group, and (F) Cis+OV2 group.

Figure 3.

Immunohistopathological changes in testicular tissue stained against 3β-hydroxysteroid dehydrogenase (3β-HSD) protein in Leydig cells (400×) (n=8 male Naval Medical Research Institute mice in each group). Yellow arrows indicate the expression of the 3β-HSD enzyme. (A) Control (C) group, (B) cisplatin group (Cis1), (C) cisplatin group (Cis2), (D) Origanum vulgare L. (OV) group, (E) Cis+OV1 group, and (F) Cis+OV2 group.

Figure 4.

Gene expression (fold change) of (A) p53 and (B) B-cell lymphoma 2 (Bcl-2) in treatment groups. Values are presented as mean±standard deviation (n=8 male MNRI mice in each group). C, control; Cis, cisplatin; OV, Origanum vulgare L. a)Significant changes compared to the C group; b)Significant changes compared to the Cis1 group; c)Significant changes compared to the Cis2 group.

Table 1.

Statistical analysis of the gonadosomatic index and testosterone in various treatment groups

TA thickness (μm) STs diameter (μm) GE height (μm) Leydig cells (N/mm2) Sertoli cells (N/ST) Spermatocytes (N/ST) ICT thickness (μm) GE degeneration (%/ST) Tes levels (ng/mL)
C 34.2±3.2 252.8±23.4 96.5±12.2 81.4±8.3 20.4±2.1 68.9±13.1 31.4±6.7 8.5±1.3 3.1±0.2
Cis1 35.7±3.5 206.7±19.3a) 67.9±11.3a) 68.5±5.9a) 16.3±2.6a) 61.4±10.3a) 19.5±4.9a) 62.3±13.1a) 0.2±0.01a)
Cis2 39.3±2.7 189.4±18.5a) 64.1±9.3a) 48.2±2.4a) 13.9±1.9a) 52.7±9.3a) 17.4±9.1a) 58.1±12.1a) 0.1±0.01a)
OV 32.4±2.5 261.1±21.4 112.4±13.1 83.9±8.9 21.4±2.1 69.7±8.4 29.4±7.1 7.2±1.9 2.9±0.3
Cis+OV1 35.5±3.1 245.9±28.3b) 89.5±9.3b) 81.6±10.1b) 18.4±2.5b) 62.3±13.1b) 29.1±4.2b) 32.3±4.6b) 2.4±0.09b)
Cis+OV2 34.7±2.9 238.5±15.7b) 87.6±8.3b) 79.4±6.2b) 18.5±3.1b) 60.4±11.9b) 26.9±7.5b) 56.7±12.3b) 2.9±0.01b)

Values are presented as mean±standard deviation (n=8 male MNRI mice in each group).

TA, tunica albuginea; ST, seminiferous tubule; GE, germinal epithelium; N, number; ICT, interstitial connective tissue; Tes, testosterone; C, control; Cis, cisplatin; OV, Origanum vulgare L.

a)

Significant changes in Cis1 and Cis2 compared to C;

b)

Significant alteration in the Cis+OV1 and Cis+OV2 groups compared to Cis2 animals.