Mitochondria-targeted antioxidant mitoquinone attenuates TGF-β–induced fibrosis and restores impaired decidualization in mouse endometrial stromal cells

Article information

Korean J Fertil Steril. 2026;.cerm.2025.08858
Publication date (electronic) : 2026 April 1
doi : https://doi.org/10.5653/cerm.2025.08858
1Department of Life Science, Graduate School, CHA University, Seongnam, Republic of Korea
2Research Competency Milestones Program of School of Medicine (RECOMP), CHA University School of Medicine, Seongnam, Republic of Korea
3Department of Biochemistry, Research Institute for Basic Medical Science, CHA University School of Medicine, Seongnam, Republic of Korea
Corresponding author: Youn-Jung Kang Department of Biochemistry, Research Institute for Basic Medical Science, CHA University School of Medicine, 335 Pangyo-ro, Bundang-gu, Seongnam 13488, Republic of Korea Tel: +82-31-881-7174 E-mail: yjkang@cha.ac.kr
*These authors contributed equally to this study.This work was supported by grants from the National Research Foundation of Korea (RS-2024-00338274) to Youn-Jung Kang.
Received 2025 October 23; Revised 2025 December 18; Accepted 2026 January 12.

Abstract

Objective

This study aimed to investigate the therapeutic effects of mitoquinone (MitoQ) in endometrial fibrosis and to examine its role in restoring impaired decidualization associated with intrauterine adhesion. We further sought to delineate the underlying mechanisms through which MitoQ exerts its protective effects. Finally, we propose mitochondrial-targeted antioxidant therapy as a potential strategy for the treatment of gynecological diseases.

Methods

An in vitro mouse endometrial fibrosis model was established by treating mouse endometrial stromal cells with transforming growth factor-β (TGF-β). MitoQ was subsequently administered to fibrotic cells to evaluate its therapeutic effects on fibrosis and defective decidualization. These effects were analyzed using quantitative real-time polymerase chain reaction, immunoblotting, immunofluorescence staining, and additional molecular and cellular assays. The underlying mechanisms were further investigated.

Results

TGF-β treatment (5 ng/mL for 48 hours) effectively induced a markedly fibrotic phenotype in mouse endometrial stromal cells. These cells were subsequently treated with 1 μM MitoQ for 24 hours. MitoQ treatment significantly reduced collagen type I alpha 1 chain (COL1A1) expression at both the mRNA and protein levels and downregulated inflammation-related markers. These effects were accompanied by reduced mitochondrial stress and suppression of suppressor of mothers against decapentaplegic (SMAD) signaling. Furthermore, MitoQ treatment restored impaired decidualization in fibrotic cells, as supported by increased expression of prolactin and insulin-like growth factor binding protein 1 (IGFBP1).

Conclusion

MitoQ treatment effectively attenuates TGF-β-induced endometrial fibrosis by reducing collagen deposition and inflammatory marker expression, while restoring impaired decidualization. These findings suggest that MitoQ may serve as a promising therapeutic candidate for fibrosis-associated uterine dysfunction.

Introduction

Intrauterine adhesion (IUA), also referred to as Asherman’s syndrome (AS), is a pathological condition characterized by fibrotic remodeling of the uterine cavity. This condition most commonly arises as a consequence of physical trauma to the endometrium, particularly following dilatation and curettage procedures [1,2]. The injury is accompanied by inflammatory responses that promote excessive connective tissue deposition and reduced endometrial vascularization, ultimately disrupting normal endometrial physiology [3,4]. As a result, these pathological alterations are associated with a broad spectrum of clinical manifestations, including amenorrhea, infertility, and recurrent pregnancy loss [2]. Even when conception is achieved, patients with IUA remain at increased risk for adverse pregnancy outcomes. Specifically, pregnancies in women with IUA are associated with significantly lower birth weights and a higher incidence of intrauterine growth restriction (IUGR), indicating impaired placentation and abnormal endometrial–placental interactions [5,6]. Although hysteroscopic adhesiolysis is currently considered the gold standard treatment for IUA, its clinical effectiveness is limited by high rates of adhesion recurrence and persistent pregnancy-related complications, underscoring the need for alternative therapeutic strategies that address the underlying fibrotic pathology [2,5].

Mitoquinone (MitoQ) is a mitochondria-targeted antioxidant designed to selectively accumulate within the mitochondrial matrix, where it efficiently neutralizes reactive oxygen species (ROS) and limits oxidative damage [7]. In addition to its antioxidant capacity, MitoQ has attracted increasing interest as a therapeutic agent in multiple disease contexts, including cardiovascular disease, liver cirrhosis, and vascular fibrosis, largely due to its reported anti-fibrotic effects [8-10]. In contrast, its potential application in reproductive medicine remains poorly characterized, with only a limited number of studies demonstrating anti-fibrotic efficacy in ovarian fibrosis [11,12]. To date, no studies have directly examined the role of mitochondria-targeted antioxidants in endometrial fibrosis. Nevertheless, accumulating evidence suggests that oxidative stress plays a critical role in fibrotic remodeling of the endometrium. For instance, an injectable antioxidant hyaluronan–chitosan hydrogel was shown to reduce collagen deposition and promote tissue regeneration in a mouse model of endometrial injury, while a Ru single-atom nanozyme–chitosan hydrogel similarly alleviated fibrosis in an IUA model through ROS scavenging [13,14]. Moreover, the mitochondrial-derived peptide analogue humanin has been reported to suppress epithelial ferroptosis and attenuate fibrotic remodeling in an AS-like injury model [15]. Collectively, these findings underscore the pathological relevance of oxidative stress in IUA and provide a compelling rationale for investigating mitochondria-targeted antioxidant strategies such as MitoQ in endometrial fibrosis.

In this study, we aimed to determine whether MitoQ serves as a potential therapeutic agent for endometrial fibrosis in an IUA model. Using a transforming growth factor-β (TGF-β)-induced endometrial fibrosis system, we evaluated the capacity of MitoQ to modulate pro-fibrotic signaling pathways and to restore the decidualization potential of endometrial cells. By addressing the largely unexplored role of mitochondria-targeted antioxidants in endometrial fibrosis, this study sought to provide foundational evidence for the therapeutic potential of MitoQ in IUA.

Methods

1. Animals

Six- to 8-week-old female C57BL/6 mice were purchased from Orientbio and maintained in a specific pathogen-free facility under a 12-hour light/dark cycle. All animal procedures were conducted in accordance with institutional guidelines and were approved by the CHA University Institutional Animal Care and Use Committee (IACUC; approval number: 230071).

2. Isolation and culture of mouse endometrial stromal cells

Mouse uteri were harvested, finely minced, and enzymatically digested using a solution containing dispase II (Sigma) and collagenase V (Sigma) for 15 minutes. Following digestion, stromal cell fractions were isolated by serial filtration through 100- to 40-µm nylon mesh filters (SPL). The resulting filtrates were collected by centrifugation and subsequently cultured in Dulbecco's Modified Eagle Medium (DMEM)/F12 medium supplemented with 20% fetal bovine serum (FBS), 1% L-glutamine, and 1% penicillin–streptomycin (all from Gibco) under standard culture conditions (5% CO₂, 37°C).

3. Characterization of mouse endometrial stromal cells

To characterize the cellular identity of mouse endometrial stromal cells (mEnSCs), cells were seeded onto glass coverslips and fixed with 4% paraformaldehyde for 15 minutes at room temperature. Fixed cells were permeabilized with 0.1% Triton X-100 in phosphate-buffered saline (PBS) for 10 minutes and subsequently blocked using a 5% bovine serum albumin (BSA; Sigma) solution to reduce nonspecific binding. Cells were then incubated with primary antibodies against F-actin (1:100; A22287, Invitrogen), vimentin (1:200; #12020, Cell Signaling), and E-cadherin (1:200; SC-21791, Santa Cruz) to evaluate stromal and epithelial marker expression. Following washing, cells were incubated with fluorophore-conjugated secondary antibodies for 1 hour at room temperature in the dark, after which nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1,000, Invitrogen).

4. Drug treatments

Recombinant mouse TGF-β (R&D Systems) was initially reconstituted in 10 mM citrate buffer (pH 3.0; Biosesang) and subsequently diluted in Dulbecco’s PBS (Gibco) containing 0.1% BSA to generate stock solutions. For experimental use, these stock solutions were further diluted in culture medium to obtain the indicated working concentrations. MitoQ (Abcam) was prepared as a stock solution by dissolving 5 mg of powder (molecular weight 583.7 g/mol) in dimethyl sulfoxide, yielding a final concentration of approximately 8.6 mM. The solution was gently vortexed until fully dissolved, aliquoted to avoid repeated freeze–thaw cycles, and stored according to the manufacturer’s instructions. For all experiments, MitoQ stock solutions were diluted in culture medium to achieve the desired final concentrations.

5. Induction of an in vitro endometrial fibrosis model and MitoQ treatment

To induce fibrotic activation, mEnSCs (1×10⁵ cells) were seeded into 6-well plates (SPL) and stimulated with TGF-β (5 ng/mL) for 48 hours. After 48 hours of TGF-β exposure, the culture medium was replaced, and cells were subsequently treated with MitoQ (1 µM) for an additional 24 hours.

6. In vitro decidualization

mEnSCs were cultured in differentiation medium consisting of DMEM/F12 supplemented with 10% FBS (Gibco), 1 µM progesterone (P4; Sigma), 0.5 mM 8-bromo-cyclic adenosine monophosphate (cAMP; Sigma), and 1% penicillin–streptomycin (Gibco), as previously described [16]. The differentiation medium was refreshed every 2 days over a total period of 6 days. To induce defective decidualization, cells were continuously exposed to TGF-β (2 ng/mL) throughout the differentiation period and subsequently treated with MitoQ (1 µM) for 48 hours.

7. Immunoblotting analysis

Collected cells were lysed with radioimmunoprecipitation assay buffer supplemented with protease and phosphatase inhibitors (Thermo). Equal amounts of protein (15 to 30 µg) were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. Nonspecific binding sites were blocked with 5% BSA for 1 hour, after which the membranes were incubated overnight with primary antibodies against collagen type I alpha 1 chain (COL1A1; 1:500; sc-293182, Santa Cruz), and β-actin (1:5,000; #3700, Cell Signaling). Membranes were then washed and incubated with horseradish peroxidase-conjugated secondary antibodies. Signals were developed using enhanced chemiluminescence detection reagent (Thermo) and visualized by LAS-4000 system (GE Healthcare).

8. Quantitative real-time polymerase chain reaction-based analysis of mRNA expression

Total RNA was extracted using the TRIzol reagent, and 1 µg of RNA was reverse-transcribed using SuperScript IV (Invitrogen). Quantitative real-time polymerase chain reaction (qRT-PCR) was performed using SYBR Green chemistry on a CFX Connect Real-Time PCR Detection System (Bio-Rad). Relative mRNA expression levels were calculated using the ΔΔCt method, with Actb used as the internal reference gene for normalization. Primer sequences are provided in Table 1.

Primer pairs used for quantitative real-time polymerase chain reaction analyses

9. Assessment of mitochondrial ROS by live-cell imaging

To assess mitochondrial ROS levels, cells were incubated with MitoSOX Red (Invitrogen) in phenol red-free Hank’s balanced salt solution (HBSS; Gibco) for 30 minutes at 37 °C. Fluorescence images were acquired using an Axiovert 200M microscope (Carl Zeiss), and relative fluorescence intensities were quantified using ImageJ software (National Institutes of Health).

10. Immunofluorescent staining

Cells were seeded onto glass coverslips, fixed with 4% paraformaldehyde for 15 minutes at room temperature, and permeabilized with 0.1% Triton X-100 in PBS for 10 minutes. After blocking with 5% BSA for 1 hour, cells were incubated overnight at 4 °C with primary antibodies against total suppressor of mothers against decapentaplegic 2 (SMAD2), phospho-SMAD2, total SMAD3, and phospho-SMAD3 (1:100; SMAD2/3 Antibody Sampler Kit, #12747, Cell Signaling), prolactin (PRL; 1:200; SC-271773, Santa Cruz), and insulin-like growth factor binding protein 1 (IGFBP1; 1:200; ab228741, Abcam). Following washing, cells were incubated with fluorophore-conjugated secondary antibodies for 1 hour at room temperature in the dark, and nuclei were counterstained with DAPI (1:1,000; Invitrogen).

11. Statistical analysis

All statistical analyses were performed using GraphPad Prism ver. 6.0 ( GraphPad Software Inc.). Data are presented as the mean±standard deviation. Comparisons among groups were conducted using ordinary one-way analysis of variance followed by the Dunnett multiple-comparison test. A p-value <0.05 was considered statistically significant (p<0.05, p<0.01, p<0.001, and p<0.0001). All experiments were independently repeated at least three times.

Results

1. TGF-β treatment induces fibrotic activation in mEnSCs

TGF-β is a well-established central regulator of tissue fibrosis in both in vivo and in vitro settings [17-20]. Before establishing an in vitro endometrial fibrosis model, isolated mEnSCs were first characterized to confirm their stromal identity (Figure 1A). The cells displayed a typical fibroblast-like morphology, characterized by prominent F-actin stress fiber organization and strong cytoplasmic vimentin expression, while E-cadherin staining was undetectable, confirming the absence of epithelial cell contamination. To induce fibrotic activation, mEnSCs were treated with increasing concentrations of TGF-β (2, 5, and 10 ng/mL) for 24 or 48 hours. TGF-β stimulation resulted in pronounced morphological alterations in mEnSCs (Figure 1B). Compared with untreated controls, TGF-β-treated cells progressively adopted an elongated morphology with fibroblast-like and branch-like extensions in both a time- and dose-dependent manner. This morphological transition was accompanied by corresponding changes in protein expression, as assessed by immunoblotting analysis (Figure 1B). Specifically, expression of COL1A1, a key marker of fibrogenesis, increased in a time-dependent fashion, with the most pronounced upregulation observed following treatment with 5 ng/mL TGF-β for 48 hours (Figure 1C). Collectively, these findings demonstrate that TGF-β robustly induces fibrotic activation in mEnSCs, with 5 ng/mL for 48 hours representing the optimal induction condition for subsequent experiments.

Figure 1.

Morphological and molecular features of fibrosis induced by transforming growth factor-β (TGF-β) in mouse endometrial stromal cells (mEnSCs). (A) Characterization of isolated mEnSCs by immunocytochemical staining for vimentin and F-actin (scale bar=200 μm). (B) Representative morphological images of mEnSCs following TGF-β treatment at different concentrations (2, 5, and 10 ng/mL) at indicated time points (0, 24, and 48 hours) (scale bar=100 μm). (C) Immunoblotting analysis for collagen type I alpha 1 chain (COL1A1) protein expression in each group. β-Actin was used as a loading control. All experiments were repeated three times (biological replicates). DAPI, 4′,6-diamidino-2-phenylindole.

2. MitoQ alleviates TGF-β–induced fibrotic changes in mEnSCs

To assess the anti-fibrotic effects of MitoQ, TGF-β-induced fibrotic mEnSCs were treated with 1 µM MitoQ for 24 hours (Figure 2A). Anti-fibrotic responses were evaluated using a combination of morphological assessment and protein and gene expression analyses (Figure 2B-D). Morphological examination revealed that MitoQ treatment markedly attenuated fibrotic features, as evidenced by a loss of the slender, branch-like fibroblast morphology and a gradual return toward a more compact cellular architecture resembling that of untreated cells (Figure 2B). These morphological changes were accompanied by a substantial reduction in COL1A1 protein expression (Figure 2C). Consistent with these findings, mRNA expression levels of fibrosis-associated and pro-inflammatory genes, including Col1a1, Tgfb1, Timp1, and Tnf, were significantly downregulated following MitoQ administration in TGF-β-treated cells (Figure 2D). Taken together, these results indicate that MitoQ effectively mitigates TGF-β-induced fibrotic alterations in mEnSCs at both morphological and molecular levels.

Figure 2.

Alleviated fibrotic phenotypes in transforming growth factor-β (TGF-β)-treated mouse endometrial stromal cells (mEnSCs) following mitoquinone (MitoQ) treatment. (A) Experimental schedule for MitoQ treatment in TGF-β-treated mEnSCs. (B) Representative morphological images of non-treated and MitoQ-treated TGF-β-treated mEmSCs (scale bar=100 μm). (C) Immunoblotting analysis for collagen type I alpha 1 chain (COL1A1) protein expression (left) and quantification of band intensity (right). β-Actin was used as a loading control. (D) Quantitative real-time polymerase chain reaction analyses of a fibrosis-related marker (Col1a1) and inflammation-related markers (Tgfb1, Timp1, and Tnf) in each group. All experiments were repeated three times (biological replicates). Data were expressed as mean±standard deviation, analyzed using the unpaired t-test (C) or ordinary one-way analysis of variance with the Tukey multiple-comparison test (D). NS, not significant. a)p<0.05; b)p<0.01; c)p<0.001.

3. MitoQ attenuates mitochondrial oxidative stress and modulates TGF-β–associated SMAD2/3 signaling in mEnSCs

Based on the observed anti-fibrotic effects of MitoQ, we next explored potential downstream mechanisms underlying these responses. Given the established role of MitoQ in protecting against mitochondrial oxidative damage, mitochondrial superoxide levels were first assessed in fibrosis-induced mEnSCs following MitoQ treatment. As expected, MitoQ administration resulted in a marked reduction in mitochondrial superoxide accumulation compared with untreated TGF-β–induced fibrotic cells (Figure 3A, 3B). Because activation of the SMAD2/3 signaling pathway is a canonical downstream event in TGF-β–mediated fibrogenesis [21,22], we next examined whether MitoQ treatment influenced SMAD signaling dynamics. Specifically, we analyzed the expression and subcellular localization of total SMAD2, phospho-SMAD2, total SMAD3, and phospho-SMAD3 at the cellular level (Figure 3C, 3D). Total SMAD2 and SMAD3 remained predominantly localized in the cytoplasm across all experimental conditions. In contrast, TGF-β stimulation induced robust phosphorylation of both proteins and promoted their nuclear translocation. Although nuclear accumulation of phospho-SMAD2 and phospho-SMAD3 was markedly increased in TGF-β-treated cells, this response was substantially attenuated following MitoQ treatment.

Figure 3.

Underlying mechanisms of mitoquinone (MitoQ) treatment in transforming growth factor-β (TGF-β)-treated mouse endometrial stromal cells (mEnSCs). (A) Representative MitoSOX Red fluorescence images of normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs (scale bar=200 μm). (B) Quantification of MitoSOX fluorescence intensity among groups. (C, D) Immunofluorescence images for suppressor of mothers against decapentaplegic 2 (SMAD2) and pSMAD2 (left) and SMAD3 and pSMAD3 (right) in normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs. Protein intensities were quantified and presented in the corresponding graphs. All experiments were repeated three times (biological replicates). Data were expressed as mean±standard deviation, analyzed using ordinary one-way analysis of variance with the Tukey multiple-comparison test (B, D). NS, not significant; DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.05; b)p<0.01; c)p<0.001.

4. MitoQ restores TGF-β-impaired decidualization in mEnSCs

In addition to its effects on fibrotic activation, we next examined whether MitoQ influences decidualization capacity under fibrotic conditions. mEnSCs were seeded, and in vitro decidualization was initiated from day 1. To model chronic fibrotic stress during prolonged differentiation, a low concentration of TGF-β (2 ng/mL) was applied throughout the culture period, and MitoQ was subsequently introduced on day 6 (Figure 4A). Morphological analysis demonstrated that MitoQ treatment alleviated fibrotic alterations and restored hallmark features of decidualized cells, including nuclear enlargement and a differentiated, epithelioid-like morphology [23], which were suppressed by TGF-β exposure (Figure 4B). At the transcriptional level, qRT-PCR analysis revealed significant upregulation of decidualization-associated genes, including Prl8a2, Prl3c1, Hand2, and Igfbp1, following MitoQ treatment, thereby counteracting the inhibitory effects of TGF-β (Figure 4C). Consistent with these findings, immunofluorescence analysis showed increased expression of PRL and IGFBP1 in MitoQ-treated cells (Figure 4D, 4E), which was further supported by quantitative signal analysis (Figure 4E). Collectively, these data demonstrate that MitoQ rescues TGF-β-induced, fibrosis-mediated impairment of decidualization through both morphological restoration and reactivation of decidualization marker expression.

Figure 4.

Restored decidualization in transforming growth factor-β (TGF-β)-treated mouse endometrial stromal cells (mEnSCs) following mitoquinone (MitoQ) treatment. (A) Experimental timeline for establishing defective decidualization and MitoQ treatment. (B) Representative morphological images of normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs under in vitro decidualization (scale bar=100 μm). (C) Relative mRNA expression levels of Prl8a2, Prl3c1, Igfbp1, and Hand2 among groups. (D) Immunofluorescence images for prolactin (PRL; green) and insulin-like growth factor binding protein 1 (IGFBP1; red) in normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs under in vitro decidualization. Nuclei are stained with 4′,6-diamidino-2-phenylindole (DAPI; blue). (E) Quantification of PRL and IGFBP1 fluorescence intensities. All experiments were repeated three times (biological replicates) (scale bar=200 μm). Data were expressed as mean±standard deviation, analyzed using ordinary one-way analysis of variance with the Tukey multiple-comparison test (C, E). NS, not significant. a)p<0.05; b)p<0.01; c)p<0.001.

Discussion

Fibrosis represents a final common pathological endpoint in many chronic organ disorders; however, the molecular mechanisms that drive its initiation and progression remain incompletely understood. Increasing evidence has identified oxidative stress as a central contributor to fibrotic remodeling across diverse tissues, thereby motivating investigation into mitochondria-targeted antioxidants such as MitoQ [24-26]. Despite this growing interest, the application of such approaches to uterine fibrosis remains largely unexplored, with only limited evidence available in uterine disorders and no studies directly evaluating their efficacy in IUA [27-29]. Addressing this gap, we investigated the therapeutic potential of MitoQ using a TGF-β-induced endometrial fibrosis model in mEnSCs. In this system, MitoQ treatment markedly attenuated fibrotic features and was accompanied by suppression of TGF-β/SMAD2/3 signaling, together with a reduction in mitochondrial oxidative stress, as demonstrated by complementary morphological and molecular analyses (Figure 3). Taken together, these findings indicate that MitoQ treatment alleviates redox stress and is associated with altered SMAD signaling responses to TGF-β stimulation. Given the well-established role of oxidative stress in regulating TGF-β/SMAD pathway activity, these parallel effects suggest that redox modulation may contribute to the observed attenuation of fibrotic signaling [30,31]. Nevertheless, the present dataset does not permit clear discrimination between a direct regulatory effect of MitoQ on SMAD signaling components and an indirect effect mediated through reduced oxidative stress. Accordingly, our findings support an association between ROS modulation and reduced SMAD2/3 activation, rather than direct mechanistic inhibition of the SMAD pathway. Through regulation of this redox-responsive signaling axis, MitoQ may ultimately constrain fibrotic remodeling and promote a stromal microenvironment more compatible with physiological endometrial function. Further mechanistic studies will be required to delineate the precise molecular basis of this association. Beyond its anti-fibrotic effects, MitoQ also partially restored impaired decidualization capacity in fibrotic mEnSCs. This restoration was supported by increased expression of decidualization-related markers and recovery of characteristic decidual morphology (Figure 4). The observed improvement likely reflects, at least in part, alleviation of fibrotic stress and a shift toward a more permissive stromal environment. Although moderate levels of ROS have been reported to support decidualization under physiological conditions [32,33], our findings indicate that decidualization can recover even under conditions of reduced oxidative stress. These observations highlight the context-dependent role of ROS signaling in decidualization and suggest that excessive or sustained oxidative stress may be more detrimental than beneficial in fibrotic settings. Importantly, further studies will be required to determine whether MitoQ directly influences decidualization pathways or whether the observed rescue primarily arises as a downstream consequence of its anti-fibrotic effects.

Clinically, IUA is associated with infertility, recurrent implantation failure, and pregnancy loss [1,34]. Moreover, accumulating evidence indicates that obstetric outcomes remain suboptimal despite current interventions, with affected women exhibiting higher rates of placenta-related disorders, IUGR, and lower birth weights compared with women without IUA [5,6]. These observations underscore the limitations of existing treatment strategies and highlight the need for novel therapeutic approaches that address the underlying endometrial pathology rather than adhesions alone. By alleviating TGF-β-induced defective decidualization, MitoQ may improve the functional quality of the endometrial environment and thereby contribute to improved pregnancy outcomes. Given that IUGR frequently arises as a secondary consequence of inadequate placentation associated with dysregulated endometrial remodeling, its prevention or mitigation may be achievable indirectly through reduction of fibrotic burden and enhancement of endometrial receptivity. Although the present study does not directly assess pregnancy outcomes or IUGR, our findings provide a strong experimental rationale for further investigation of MitoQ in this context. To our knowledge, this study represents the first proof-of-concept demonstration of mitochondria-targeted antioxidant therapy in the setting of IUA. While comparative studies with other antioxidant strategies are warranted, the current findings offer foundational evidence supporting MitoQ as a promising therapeutic candidate. Future studies using in vivo IUA models and clinical samples will be essential to validate these observations and to further evaluate their translational potential.

Notes

Conflict of interest

Youn-Jung Kang is an editorial board member of the journal, but she was not involved in the peer reviewer selection, evaluation, or decision process of this article. No other potential conflicts.

Author contributions

Conceptualization: YJK. Formal analysis, DL, JB. Data curation, DL, JB. Funding acquisition: YJK. Project administration: YJK. Visualization: DL, JB. Supervision: YJK. writing-original draft: DL, JB. Writing review & editing: YJK. Approval of final manuscript: DL, JB, YJK.

References

1. Yu D, Wong YM, Cheong Y, Xia E, Li TC. Asherman syndrome: one century later. Fertil Steril 2008;89:759–79. 10.1016/j.fertnstert.2008.02.096. 18406834.
2. March CM. Intrauterine adhesions. Obstet Gynecol Clin North Am 1995;22:491–505. 10.1016/s0889-8545(21)00199-6. 8524533.
3. Wu J, Wang J, Pei Z, Zhu Y, Zhang X, Zhou Z, et al. Endothelial senescence induced by PAI-1 promotes endometrial fibrosis. Cell Death Discov 2025;11:89. 10.1038/s41420-025-02377-0. 40050610.
4. Chen Y, Chang Y, Yao S. Role of angiogenesis in endometrial repair of patients with severe intrauterine adhesion. Int J Clin Exp Pathol 2013;6:1343–50. 23826415.
5. Baradwan S, Baradwan A, Bashir M, Al-Jaroudi D. The birth weight in pregnant women with Asherman syndrome compared to normal intrauterine cavity: a case-control study. Medicine (Baltimore) 2018;97e11797. 10.1097/MD.0000000000011797.
6. Wang J, Movilla P, Morales B, Wang J, Williams A, Reddy H, et al. Effects of Asherman syndrome on maternal and neonatal morbidity with evaluation by conception method. J Minim Invasive Gynecol 2021;28:1357–66.e2. 10.1016/j.jmig.2020.10.004. 33065259.
7. Rossman MJ, Santos-Parker JR, Steward CA, Bispham NZ, Cuevas LM, Rosenberg HL, et al. Chronic supplementation with a mitochondrial antioxidant (MitoQ) improves vascular function in healthy older adults. Hypertension 2018;71:1056–63. 10.1161/hypertensionaha.117.10787. 29661838.
8. Ning R, Li Y, Du Z, Li T, Sun Q, Lin L, et al. The mitochondria-targeted antioxidant MitoQ attenuated PM2.5-induced vascular fibrosis via regulating mitophagy. Redox Biol 2021;46:102113. 10.1016/j.redox.2021.102113. 34425389.
9. Rehman H, Liu Q, Krishnasamy Y, Shi Z, Ramshesh VK, Haque K, et al. The mitochondria-targeted antioxidant MitoQ attenuates liver fibrosis in mice. Int J Physiol Pathophysiol Pharmacol 2016;8:14–27. 27186319.
10. Pang M, Wang S, Shi T, Chen J. Overview of MitoQ on prevention and management of cardiometabolic diseases: a scoping review. Front Cardiovasc Med 2025;12:1506460. 10.3389/fcvm.2025.1506460. 40134978.
11. Umehara T, Winstanley YE, Andreas E, Morimoto A, Williams EJ, Smith KM, et al. Female reproductive life span is extended by targeted removal of fibrotic collagen from the mouse ovary. Sci Adv 2022;8eabn4564. 10.1126/sciadv.abn4564. 35714185.
12. Del Valle JS, Van Helden RW, Moustakas I, Wei F, Asseler JD, Metzemaekers J, et al. Ex vivo removal of pro-fibrotic collagen and rescue of metabolic function in human ovarian fibrosis. iScience 2025;28:112020. 10.1016/j.isci.2025.112020. 40104066.
13. Zheng X, Huang R, Yin L, Yao M, Chu J, Yang F, et al. Injectable antioxidant hyaluronan/chitosan hydrogel as a platelet-rich plasma and stem cell carrier to promote endometrial regeneration and fertility restoration. Acta Biomater 2025;195:201–15. 10.1016/j.actbio.2025.01.062. 39894327.
14. Liang Y, Meng J, Yu Z, Guo Y, Zhang X, Yan Y, et al. Ru single-atom nanozymes targeting ROS-ferroptosis pathways for enhanced endometrial regeneration in intrauterine adhesion therapy. Biomaterials 2025;315:122923. 10.1016/j.biomaterials.2024.122923. 39489016.
15. Zou L, Huang J, Zhang Q, Mo H, Xia W, Zhu C, et al. The humanin analogue (HNG) alleviates intrauterine adhesions by inhibiting endometrial epithelial cells ferroptosis: a rat model-based study. Hum Reprod 2023;38:2422–32. 10.1093/humrep/dead196. 37814907.
16. Brar AK, Frank GR, Kessler CA, Cedars MI, Handwerger S. Progesterone-dependent decidualization of the human endometrium is mediated by cAMP. Endocrine 1997;6:301–7. 10.1007/bf02820507. 9368687.
17. Czaja MJ, Weiner FR, Flanders KC, Giambrone MA, Wind R, Biempica L, et al. In vitro and in vivo association of transforming growth factor-beta 1 with hepatic fibrosis. J Cell Biol 1989;108:2477–82. 10.1083/jcb.108.6.2477. 2500447.
18. Murray LA, Chen Q, Kramer MS, Hesson DP, Argentieri RL, Peng X, et al. TGF-beta driven lung fibrosis is macrophage dependent and blocked by serum amyloid P. Int J Biochem Cell Biol 2011;43:154–62. 10.1016/j.biocel.2010.10.013.
19. Hakenjos L, Bamberg M, Rodemann HP. TGF-beta1-mediated alterations of rat lung fibroblast differentiation resulting in the radiation-induced fibrotic phenotype. Int J Radiat Biol 2000;76:503–9. 10.1080/095530000138501. 10815630.
20. Border WA, Noble NA. Transforming growth factor beta in tissue fibrosis. N Engl J Med 1994;331:1286–92. 10.1056/nejm199411103311907.
21. Khalil H, Kanisicak O, Prasad V, Correll RN, Fu X, Schips T, et al. Fibroblast-specific TGF-β-Smad2/3 signaling underlies cardiac fibrosis. J Clin Invest 2017;127:3770–83. 10.1172/jci94753. 28891814.
22. Finnson KW, Almadani Y, Philip A. Non-canonical (non-SMAD2/3) TGF-β signaling in fibrosis: mechanisms and targets. Semin Cell Dev Biol 2020;101:115–22. 10.1016/j.semcdb.2019.11.013. 31883994.
23. Willis BC, Liebler JM, Luby-Phelps K, Nicholson AG, Crandall ED, du Bois RM, et al. Induction of epithelial-mesenchymal transition in alveolar epithelial cells by transforming growth factor-beta1: potential role in idiopathic pulmonary fibrosis. Am J Pathol 2005;166:1321–32. 10.1016/s0002-9440(10)62351-6. 15855634.
24. Ghafouri-Fard S, Askari A, Shoorei H, Seify M, Koohestanidehaghi Y, Hussen BM, et al. Antioxidant therapy against TGF-β/SMAD pathway involved in organ fibrosis. J Cell Mol Med 2024;28e18052. 10.1111/jcmm.18052. 38041559.
25. Day BJ. Antioxidants as potential therapeutics for lung fibrosis. Antioxid Redox Signal 2008;10:355–70. 10.1089/ars.2007.1916. 17999627.
26. Walters DM, Cho HY, Kleeberger SR. Oxidative stress and antioxidants in the pathogenesis of pulmonary fibrosis: a potential role for Nrf2. Antioxid Redox Signal 2008;10:321–32. 10.1089/ars.2007.1901. 17999635.
27. Saribas GS, Akarca Dizakar O, Ozogul C, Celik E, Ergoren MC. Ellagic acid increases implantation rates with its antifibrotic effect in the rat model of intrauterine adhesion. Pathol Res Pract 2023;246:154499. 10.1016/j.prp.2023.154499. 37163881.
28. Huang L, Shi L, Li M, Yin X, Ji X. Oxidative stress in endometriosis: sources, mechanisms and therapeutic potential of antioxidants (review). Int J Mol Med 2025;55:72. 10.3892/ijmm.2025.5513. 40052588.
29. Baboo KD, Chen ZY, Zhang XM. Role of oxidative stress and antioxidant therapies in endometriosis. Reprod Dev Med 2019;3:170–6. 10.4103/2096-2924.268154.
30. Jain M, Rivera S, Monclus EA, Synenki L, Zirk A, Eisenbart J, et al. Mitochondrial reactive oxygen species regulate transforming growth factor-β signaling. J Biol Chem 2013;288:770–7. 10.1074/jbc.m112.431973. 23204521.
31. Herrera B, Alvarez AM, Sanchez A, Fernandez M, Roncero C, Benito M, et al. Reactive oxygen species (ROS) mediates the mitochondrial-dependent apoptosis induced by transforming growth factor (beta) in fetal hepatocytes. FASEB J 2001;15:741–51. 10.1096/fj.00-0267com. 11259392.
32. Gao W, Feng F, Ma X, Zhang R, Li L, Yue F, et al. Progress of oxidative stress in endometrium decidualization. J Obstet Gynaecol 2022;42:3429–34. 10.1080/01443615.2022.2144171. 36373471.
33. Thapa R, Monsivais D. Mechanisms driving resistance to oxidative stress during endometrial stromal cell decidualization. Biol Reprod 2026;114:511–30. 10.1093/biolre/ioaf198. 40891509.
34. Kim MK, Yoon JA, Yoon SY, Park M, Lee WS, Lyu SW, et al. Human platelet-rich plasma facilitates angiogenesis to restore impaired uterine environments with Asherman's syndrome for embryo implantation and following pregnancy in mice. Cells 2022;11:1549. 10.3390/cells11091549. 35563855.

Article information Continued

Figure 1.

Morphological and molecular features of fibrosis induced by transforming growth factor-β (TGF-β) in mouse endometrial stromal cells (mEnSCs). (A) Characterization of isolated mEnSCs by immunocytochemical staining for vimentin and F-actin (scale bar=200 μm). (B) Representative morphological images of mEnSCs following TGF-β treatment at different concentrations (2, 5, and 10 ng/mL) at indicated time points (0, 24, and 48 hours) (scale bar=100 μm). (C) Immunoblotting analysis for collagen type I alpha 1 chain (COL1A1) protein expression in each group. β-Actin was used as a loading control. All experiments were repeated three times (biological replicates). DAPI, 4′,6-diamidino-2-phenylindole.

Figure 2.

Alleviated fibrotic phenotypes in transforming growth factor-β (TGF-β)-treated mouse endometrial stromal cells (mEnSCs) following mitoquinone (MitoQ) treatment. (A) Experimental schedule for MitoQ treatment in TGF-β-treated mEnSCs. (B) Representative morphological images of non-treated and MitoQ-treated TGF-β-treated mEmSCs (scale bar=100 μm). (C) Immunoblotting analysis for collagen type I alpha 1 chain (COL1A1) protein expression (left) and quantification of band intensity (right). β-Actin was used as a loading control. (D) Quantitative real-time polymerase chain reaction analyses of a fibrosis-related marker (Col1a1) and inflammation-related markers (Tgfb1, Timp1, and Tnf) in each group. All experiments were repeated three times (biological replicates). Data were expressed as mean±standard deviation, analyzed using the unpaired t-test (C) or ordinary one-way analysis of variance with the Tukey multiple-comparison test (D). NS, not significant. a)p<0.05; b)p<0.01; c)p<0.001.

Figure 3.

Underlying mechanisms of mitoquinone (MitoQ) treatment in transforming growth factor-β (TGF-β)-treated mouse endometrial stromal cells (mEnSCs). (A) Representative MitoSOX Red fluorescence images of normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs (scale bar=200 μm). (B) Quantification of MitoSOX fluorescence intensity among groups. (C, D) Immunofluorescence images for suppressor of mothers against decapentaplegic 2 (SMAD2) and pSMAD2 (left) and SMAD3 and pSMAD3 (right) in normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs. Protein intensities were quantified and presented in the corresponding graphs. All experiments were repeated three times (biological replicates). Data were expressed as mean±standard deviation, analyzed using ordinary one-way analysis of variance with the Tukey multiple-comparison test (B, D). NS, not significant; DAPI, 4′,6-diamidino-2-phenylindole. a)p<0.05; b)p<0.01; c)p<0.001.

Figure 4.

Restored decidualization in transforming growth factor-β (TGF-β)-treated mouse endometrial stromal cells (mEnSCs) following mitoquinone (MitoQ) treatment. (A) Experimental timeline for establishing defective decidualization and MitoQ treatment. (B) Representative morphological images of normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs under in vitro decidualization (scale bar=100 μm). (C) Relative mRNA expression levels of Prl8a2, Prl3c1, Igfbp1, and Hand2 among groups. (D) Immunofluorescence images for prolactin (PRL; green) and insulin-like growth factor binding protein 1 (IGFBP1; red) in normal (control), non-treated (TGF-β-treated), and MitoQ-treated (TGF-β-treated) mEnSCs under in vitro decidualization. Nuclei are stained with 4′,6-diamidino-2-phenylindole (DAPI; blue). (E) Quantification of PRL and IGFBP1 fluorescence intensities. All experiments were repeated three times (biological replicates) (scale bar=200 μm). Data were expressed as mean±standard deviation, analyzed using ordinary one-way analysis of variance with the Tukey multiple-comparison test (C, E). NS, not significant. a)p<0.05; b)p<0.01; c)p<0.001.

Table 1.

Primer pairs used for quantitative real-time polymerase chain reaction analyses

Species Gene Direction GenBank accession number Sequence
Mouse Actb Forward NM_007393 TCAATGGAGTAAGCCCAAAG
Reverse CAAGAGACCGAGCAATCAAG
Timp1 Forward NM_001044384 GCAACTCGGACCTGGTCATAA
Reverse CGGCCCGTGATGAGAAACT
Tgfb1 Forward NM_011577 CTAATGGTGGAAACCCACAACG
Reverse TATCGCCAGGAATTGTTGCTG
Tnf Forward NM_013693 CCCTCACACTCAGATCATCTTCT
Reverse GCTACGACGTGGGCTACAG
Col1a1 Forward NM_007742 CTGGCGGTTCAGGTCCAAT
Reverse TTCCAGGCAATCCACGAGC
Prl8a2 Forward NM_010088 AGCCTCTGCCAATCTGTTCC
Reverse AGGCCTGGCTAATTATCTTCTCA
Prl3c1 Forward NM_001163218 GCTTTCCTCTTCTCGTCACATCC 
Reverse GTGTAGAAATGGTTTGGCACATCT
Hand2 Forward NM_010402 TCGGTTATCTAGTGCTGTC
Reverse ATACTTACAATGTTTACACCTTCA
Igfbp1 Forward NM_008341 TGAACCGCATCGAGCTGAAGGG
Reverse TCCAGCAGGACCATGTGATCGC