In vitro oocyte maturation is associated with altered OCT4 promoter methylation, DNMT expression, and early embryonic development in transgenic mouse embryos

Nahid Pashaie; Delsuz Rezaee; Sara Hosseini; Mohammad Salehi

doi:10.5653/cerm.2026.09152

Clin Exp Reprod Med > Epub ahead of print

Pashaie, Rezaee, Hosseini, and Salehi: In vitro oocyte maturation is associated with altered OCT4 promoter methylation, DNMT expression, and early embryonic development in transgenic mouse embryos

Original Article

Clinical and Experimental Reproductive Medicine 2026;cerm.2026.09152.

Published online: September 9, 2026

DOI: https://doi.org/10.5653/cerm.2026.09152

In vitro oocyte maturation is associated with altered OCT4 promoter methylation, DNMT expression, and early embryonic development in transgenic mouse embryos

Nahid Pashaie¹

, Delsuz Rezaee², Sara Hosseini^3,⁴, Mohammad Salehi^3,⁴

¹Department of Biology, Faculty of Basic Science, Islamic Azad University of Hamadan, Hamedann, Iran

²Department of Genetic, School of Allied Medical Sciences, Ilam University of Medical Sciences, Ilamn, Iran

³Department of Medical Biotechnology, School of Advanced Technologies in Medicine, Shahid Beheshti University of Medical Sciences, Tehrann, Iran

⁴Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran

Corresponding author: Mohammad Salehi Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, Tehran, Iran
Tel: +98-9123372897 E-mail: m.salehi@sbmu.ac.ir

^*This work was supported by the Shahid Beheshti University of Medical Sciences, Tehran, Iran (grant number IR.REC.1396.40).

Received January 7, 2026 Revised February 28, 2026 Accepted March 6, 2026

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

Objective

In vitro oocyte maturation (IVM) is widely used in assisted reproductive technologies; however, its potential effects on epigenetic regulation and embryonic development remain incompletely understood. In this study, we compared the developmental competence and epigenetic characteristics of transgenic mouse embryos derived from in vitro-matured and in vivo-matured oocytes.

Methods

A human OCT4-enhanced green fluorescent protein (EGFP) construct was microinjected into fertilized oocytes, and embryo development was evaluated by assessing cleavage and blastocyst formation rates. The methylation status of the OCT4 promoter was assessed using methylation-specific polymerase chain reaction (PCR), and the expression levels of DNA methyltransferases (Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l) and endogenous Oct4 were analyzed using quantitative real-time PCR.

Results

Embryos derived from IVM oocytes exhibited significantly reduced cleavage and blastocyst formation rates compared with those derived from in vivo-matured oocytes. In addition, differences in OCT4 promoter methylation patterns and altered expression of DNMTs were observed between the two groups. In particular, increased Dnmt3a expression and decreased Oct4 expression were associated with embryos derived from IVM oocytes.

Conclusion

These findings suggest that IVM is associated with epigenetic alterations that may influence early embryonic development and the quality of transgenic embryos. Improved understanding of these effects may contribute to the optimization of IVM protocols and outcomes in assisted reproductive technologies.

Keywords: DNA methylation; DNA methyltransferases; Embryo development; In vitro oocyte maturation; OCT4 promoter

Introduction

Injecting genes of interest into mouse embryos is a powerful tool for studying developmental genetics. The fate of donor cells can be monitored using recombinant DNA technology. Transgenic embryos enable investigation of foreign gene functions, gene regulation processes, and the physiological roles of their gene products [1]. The natural development of mammalian embryos—from totipotent zygotes—is regulated by both genetic and epigenetic mechanisms [2]. Epigenetic mechanisms include DNA methylation, histone modifications, and chromatin remodeling, which establish cellular memory and stabilize cell fate decisions [3]. DNA methylation, a stable epigenetic modification, plays a critical role in genomic stability, cell differentiation, and embryonic development. It regulates transcription, genomic imprinting, X-chromosome inactivation, and transposon silencing [4,5]. Epigenetic reprogramming during early embryonic development is necessary for establishing totipotent or pluripotent states in subsequent cell generations [6]. Two major waves of epigenetic reprogramming occur in mammals: global demethylation and de novo methylation during gametogenesis, fertilization, and preimplantation development [7]. After active and passive demethylation in early embryogenesis, de novo methylation patterns are established and maintained by DNA methyltransferase (DNMT) enzymes, including DNMT3a, DNMT3b, DNMT3L, and DNMT1 [8,9]. OCT4, a key transcription factor, regulates the expression of genes involved in pluripotency and self-renewal while repressing differentiation-associated genes in embryonic stem cells (ESCs) and primordial germ cells [10,11]. The expression patterns of OCT4 vary across mammalian developmental stages and influence ESC differentiation [12]. Incomplete expression of OCT4 can result in fetal and placental defects, which are frequently observed in cloned animals [13]. In mice, Oct4 is highly expressed during preimplantation development, with peak expression occurring in early blastocysts. During blastocyst differentiation, de novo methylation restricts Oct4 expression to the inner cell mass (ICM), thereby reducing its expression in trophectoderm (TE) cells [14,15]. Environmental and in vitro stresses during oocyte development can disrupt cellular processes, lead to aberrant DNA methylation reprogramming, and increase susceptibility to chronic diseases later in life [16]. Similarly, exposure of oocytes to environmental or in vitro stressors during early developmental stages may disrupt cellular processes, induce abnormal DNA methylation reprogramming, impair embryonic development, and increase susceptibility to chronic and non-communicable diseases later in life [17,18]. Alongside in vitro embryo production systems, such as in vitro oocyte maturation (IVM) and in vitro fertilization (IVF), embryos generated in vitro are increasingly used for mammalian embryo production [19]. IVM is considered an alternative approach that may improve conventional IVF in assisted reproductive technologies [20]. However, environmental perturbations during IVM may induce previously unrecognized adverse epigenetic alterations in IVM-derived oocytes compared with in vivo-matured oocytes [21]. Moreover, IVM raises concerns regarding the acquisition and maintenance of DNA methylation imprinting patterns during oocyte development, which may adversely affect subsequent embryonic developmental pathways [22,23]. Previous studies in humans and animal models have shown that IVM oocytes can exhibit differential methylation patterns in the promoter regions of species-specific genes [23,24]. Consequently, the loss or aberrant acquisition of key methylation components during oocyte maturation may lead to embryo growth arrest, increased rates of multinuclear blastomeres, aneuploidy, and recurrent implantation failure [25]. Several studies have investigated the effects of various factors on embryonic development under both in vivo and IVM conditions. In the present study, we evaluated transgenic mouse embryo production by DNA microinjection into embryos derived from IVM and in vivo oocytes. We also analyzed methylation patterns of the Oct4 promoter and examined the relationship between methylation and gene expression by assessing the expression levels of Dnmt genes and Oct4 in transgenic embryos obtained through IVM and in vivo maturation.

Methods

The B6D2F1 mice were maintained in accordance with the Guideline Principles for Laboratory Animals and protocols approved by the university for the care and use of laboratory animals. The animals were housed under controlled conditions with ad libitum access to food and water at room temperature (22 °C) and under a 12-hour light/12-hour dark photoperiod. Unless otherwise stated, all chemicals were purchased from Sigma Chemical Corporation.

1. Transformation of the vector into DH5α cells and DNA purification

The phOCT4-enhanced green fluorescent protein (EGFP) plasmid was purchased from Addgene and introduced into Escherichia coli DH5α. The phOCT4-EGFP vector was chemically transformed into competent E. coli DH5α cells using the calcium chloride method. In positive colonies, the phOCT4-EGFP plasmid was extracted using a Macherey-Nagel extraction kit according to the manufacturer’s instructions. The H-OCT4-EGFP fragment was excised from the plasmid by restriction enzyme digestion with nocardia otitidis (NotI) and bacillus globigii (BglII). The gene construct consisted of selected portions of the region upstream of the OCT4 gene as the promoter and EGFP as the reporter in the phOCT4-EGFP vector. After confirmation of the accuracy and size of the DNA fragment, the amplified polymerase chain reaction (PCR) products on agarose gel were purified using the QIAEX II Gel Extraction Kit (Qiagen) according to the manufacturer’s instructions. The purified construct was quantified by optical density and diluted in TE buffer (pH=7.3). The DNA solution was stored at −20 °C before microinjection.

2. Matured in vivo oocytes and in vitro maturation of oocyte complexes

To obtain in vivo-matured oocytes, female B6D2F1 mice aged 6 to 8 weeks were superovulated with 10 IU pregnant mare serum gonadotropin (PMSG) by intraperitoneal injection, followed by injection of human chorionic gonadotropin (HCG) 48 hours later. Cumulus-oocyte complexes (COCs) were collected by tearing the ampulla of the oviduct 13 to 14 hours after HCG injection. To obtain IVM oocytes, ovaries were collected from 6- to 8-week-old female mice 50 hours after injection of 10 IU PMSG. The COCs harvested from each follicle were washed in 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-buffered tissue culture medium 199 (TCM-199) medium supplemented with 10% fetal bovine serum (FBS; Gibco, Invitrogen). Next, the COCs were matured in TCM-199 supplemented with 0.2 mmol/L sodium pyruvate, 2 mmol/L L-glutamine, 10 μg/mL follicle-stimulating hormone, 10 μg/mL luteinizing hormone, 1 μg/mL beta-estradiol, and 10% FBS for 22–24 hours at 37 °C in 5% CO₂. After IVM, the COCs were washed in human tubal fluid (HTF) medium supplemented with 4 mg/mL bovine serum albumin (BSA). For both the in vivo and IVM groups, the oocytes were then used for IVF.

3. In vitro fertilization

Isolated COCs were placed in flushing and holding medium (FHM) and then transferred to 50-μL drops of HTF medium containing 4 mg/mL BSA under mineral oil. For sperm collection, mature spermatozoa were obtained from the cauda epididymis and vasa deferentia. The sperm suspension was placed in a prewarmed petri dish containing 0.5 mL HTF medium supplemented with 4 mg/mL BSA. The dish was incubated in a humidified atmosphere at 37 °C and 5% CO₂ for 45 minutes to allow capacitation and swim-up. For IVF, approximately 1×10⁶ capacitated sperm/mL were added to 50-μL droplets of HTF fertilization medium containing the COCs. The mixture was incubated for 6 hours at 37 °C in a humidified atmosphere containing 5% CO₂. The presumptive embryos were then cultured for 24 hours in potassium simplex optimized medium (KSOM) supplemented with 4% BSA under mineral oil at 37 °C in a humidified atmosphere containing 5% CO₂. Embryo development was assessed at 24 and 96 hours after IVF to evaluate fertilization and blastocyst formation rates, respectively [26,27].

4. Pronuclear injection of DNA in the IVM- and in vivo-matured oocytes

Six hours after insemination, fertilized oocytes were transferred into 10-μL droplets of FHM medium in the center of a petri dish. The selected OCT4-EGFP construct was introduced using microinjectors connected to a microscope with Hoffman modulation contrast, which enabled visualization of the pronuclei at ×40 magnification. DNA was injected into the male pronucleus at a concentration of 2 ng/μL, and the pronuclear volume approximately doubled after injection. Swelling of the pronucleus was considered an indication of successful injection; if no swelling was observed, the injection was considered unsuccessful. The injected embryos were immediately removed, placed in KSOM droplets overlaid with mineral oil, and maintained in an incubator. Blastocyst formation was assessed at 96 hours after fertilization. Green fluorescent protein (GFP)-positive blastocysts were used in subsequent experiments.

5. Evaluation of the presence of OCT4-EGFP DNA and GFP expression in microinjected embryos

The presence and expression of OCT4-EGFP DNA in microinjected embryos were evaluated by fluorescence microscopy. Noninjected embryos derived from both the in vivo and IVM groups were used as control groups.

6. Bisulfite-treated DNA

After DNA synthesis in GFP-positive embryos derived from the in vivo and IVM groups, the DNA was treated with bisulfite using the EZ DNA methylation-lightning kit (Zymo Research) according to the manufacturer’s protocol. To identify, investigate, and compare methylated and unmethylated regions of the injected human OCT4 promoter in the two groups, methylation-specific PCR (MSP) was performed using MSP-H-OCT4 promoter primers in a reaction mixture containing 25 μL 2X Zymo Taq qPCR PreMix (Zymo Research), 3 μL template DNA, and 3.5 μL (10 μM) of each primer, with double-distilled water added to a final volume of 50 μL. The reaction conditions included an activation step at 95 °C for 10 minutes, followed by 45 cycles of 94 °C for 30 seconds, 60 °C for 40 seconds, and 72 °C for 55 seconds. A final extension step of 10 minutes at 72 °C was followed by cooling at 4 °C. DNA from noninjected embryos was used as the control group. Primers for the human OCT4 promoter were designed using Methyl Primer Express v1.0 (Applied Biosystems) and Bisulfite Primer Seeker software (Zymo Research) to investigate methylation in cytosine-phosphate-guanine (CpG) regions. The primer sequences were as follows: forward, 5′-GGGGAGTTTAGGGTAGTTTTTTT-3′; reverse, 5′-TCCCCTCACACAAAATCCCCTTC-3′.

7. RNA isolation, cDNA synthesis, and quantitative real-time-PCR analysis

Primers were designed using Gene Runner version 5.1 (Informer Technologies Inc.) and Oligo 7 software (Molecular Biology Insights Inc.). The primer information is presented in Table 1. Reverse transcription and quantitative PCR were used to assess the expression of the studied genes as previously described [28,29]. Hypoxanthine phosphoribosyltransferase 1 (Hprt1) was used as the reference gene. Relative expression was determined using the 2^−ΔΔCT method.

8. Immunofluorescence staining technique

To assess the presence of the OCT4 protein in oocytes, immunofluorescence staining was performed as previously described by Szczepanska et al. [11]. Briefly, oocytes were fixed in 4% paraformaldehyde containing 0.1 mg/mL polyvinyl alcohol for 60 minutes. The fixed oocytes were blocked for 40 minutes at 4 °C and then incubated for 1 hour with a primary antibody against OCT4 (1:200). The oocytes were then rinsed with phosphate-buffered saline and incubated for 1 hour with a fluorescein isothiocyanate-conjugated secondary antibody (1:500). Nuclei were counterstained with 5 μg/mL 4′,6-diamidino-2-phenylindole (DAPI) for 5 to 10 seconds and visualized using a fluorescence microscope. Blastocyst cells were counted, and the percentages of OCT4 expression in the TE and ICM were analyzed and compared using SPSS software ver. 25.0 (IBM Corp.).

Depending on OCT4 expression level, blastocysts were classified into four grades: grade I, OCT4 protein was detected in all nuclei of cells comprising both the ICM and TE; grade II, OCT4 protein was present in all nuclei of ICM and TE cells, but its level was lower in TE than in the ICM; grade III, OCT4 protein was present in all nuclei of ICM cells and in only some nuclei of TE cells; and grade IV, OCT4 protein was detected only in ICM nuclei [11].

9. Statistical analysis

All data were analyzed using SPSS ver. 25.0 (SPSS Inc.). Developmental outcomes were analyzed using the nonparametric Mann–Whitney test and the chi-square test. Relative expression levels of genes were evaluated using REST 2009 software (Qiagen). Results are presented as mean±standard deviation, and p<0.05 was considered statistically significant.

10. Ethical approval

This study was approved by the Research and Ethics Committee of the Shahid Beheshti University of Medical Sciences, Tehran, Iran (IR.REC.1396.40). Written informed consent is not applicable to our study because no human subjects or human materials were used.

Results

1. Confirmation of isolated OCT4-EGFP DNA fragment

Observation of an 8,068-bp band on agarose gel confirmed successful plasmid extraction (Figure 1A). To generate the OCT4-EGFP fragment, the phOCT4-EGFP vector was digested with the restriction enzymes NotI and BglII, yielding a specific 4,709-bp amplified product corresponding to the OCT4-EGFP fragment (Figure 1B).

2. IVM declined the rates of fertilization, cleavage, and embryo development

To examine embryonic development in the IVM and in vivo groups, along with their respective controls, the numbers of embryos progressing from the two-cell stage to the blastocyst stage were counted, and the mean percentage of embryonic development at each stage was calculated. The developmental progression of embryos from the two-cell stage to the blastocyst stage is shown in Figure 2A. The analysis demonstrated a significant decrease in cleavage and blastocyst formation rates in the IVM group compared with the in vivo group (p<0.05) (Table 2). The fertilization rate in the IVM group was 83.86%, compared with 95.76% in the in vivo group. According to Table 2, the blastocyst formation rate in in vivo-derived oocytes was substantially higher than that in IVM-matured oocytes.

3. Validation of injected OCT4-EGFP fragment into embryos by microscopic examination of GFP expression and PCR

After pronuclear injection, GFP expression was observed in blastocyst-stage embryos derived from both IVM and in vivo oocytes by fluorescence microscopy. No GFP expression was observed in control embryos without pronuclear injection in either group (Figure 2B).

4. The introduction of OCT4-EGFP DNA into embryos affected the rates of fertilization, cleavage, and embryo development

Oocytes derived from in vivo and IVM procedures were microinjected with DNA. Fertilization rates and embryo development after DNA transfer were compared to determine whether microinjection adversely affected embryo development. As shown in Table 2, fertilization rates were higher in the control groups (95.76% and 83.86% for in vivo and IVM, respectively) than in the microinjected groups (69.21% and 40.79%, respectively). These differences were statistically significant. Cleavage rates from the four-cell stage to the morula stage were also higher in the control groups than in the microinjected groups, and these differences were statistically significant. Similarly, blastocyst formation rates were significantly higher in the control groups (p<0.05) (Table 2).

5. Effects of bisulfite treatment on DNA methylation

MSP was used to assess the methylation level of the OCT4 promoter in cumulus cells from the IVM, in vivo, and control groups. The presence of 339-bp bands on agarose gel indicated methylation of the OCT4 promoter in both the IVM and in vivo groups. The methylated OCT4 promoter band was more intense in the in vivo group than in the IVM group, suggesting different methylation levels between the groups. No bands were observed in the control groups (Figure 3C).

6. Effect of OCT4-EGFP microinjection on transcript frequencies (Oct4, Dnmt3b, Dnmt1, Dnmt3a, and Dnmt3l) in microinjected IVM and in vivo embryos

RNA was extracted from microinjected embryos in both groups to evaluate gene expression levels. As shown in Figure 3A, microinjection of OCT4-EGFP DNA significantly affected the relative abundance of transcripts of the studied genes in blastocyst-stage embryos. Dnmt3a transcript levels were elevated in IVM embryos compared with in vivo embryos, showing a 2.25-fold increase in the IVM group. In contrast, Dnmt3l expression was reduced in the IVM group, although this difference did not reach statistical significance. No significant differences were observed in Dnmt1 or Dnmt3b expression between the groups. A significant decrease (p<0.05) in Oct4 expression was observed in the IVM group compared with the in vivo group (Figure 3B).

7. Immunostaining of OCT4 expression in cumulus cells

To evaluate OCT4 protein expression, immunocytochemistry was performed. OCT4 was detected in both IVM and in vivo cumulus cells (Figure 4A). As shown in Figure 4B, the intensity and accumulation of OCT4 protein expression increased with blastocyst development and expansion. This progression was more pronounced in the in vivo group, which advanced from grade I to grade III, than in the IVM group, which progressed from grades III and II to grade I.

Discussion

Transgenesis is an essential tool for investigating individual genes within their natural complex environments. Transgenic animal technology is now widely used for the rapid and relatively straightforward analysis of gene expression and function. Transgenic animals can be produced through IVF or IVM of oocytes, followed by DNA microinjection into zygotes [1]. The use of high-quality immature oocytes and the provision of an optimal environment for their growth and maturation are essential for successful fertilization, preimplantation embryo development, fetal growth, and offspring health [30]. However, environmental stressors during IVM may lead to unrecognized epigenetic defects in oocytes and thereby impair normal fetal differentiation and growth [21,31]. Abnormal acquisition and maintenance of DNA methylation patterns during germ cell identity establishment may disrupt the expression of key pluripotency genes and potentially affect fetal development. DNMTs, including both embryonic and maternal forms, are critical for maintaining methylation patterns established during early embryonic development [32]. In this study, we generated transgenic embryos from IVM- and in vivo-matured oocytes by microinjecting an OCT4 promoter gene into zygotes. We then analyzed DNA methylation patterns in the OCT4 promoter and examined changes in the expression of Dnmt1, Dnmt3a, Dnmt3b, Dnmt3l, and Oct4 in these embryos. Oct4 is a key transcription factor that regulates pluripotency, differentiation, and maintenance of the ICM [11,33]. The highest levels of promoter methylation typically occur in CpG-rich regions and are associated with gene silencing [34,35]. To evaluate the effect of oocyte maturation conditions on DNA methylation, we injected a human OCT4 promoter fragment into the pronucleus of mature oocytes from both groups. Our MSP results indicated that methylation of the exogenous OCT4 promoter in cumulus cells from in vivo-matured oocytes was higher than that in the IVM group. However, greater MSP band intensity does not necessarily indicate a higher methylation level. De novo methylation begins after integration of an exogenous fragment into the genome, and the fragment may also have been subjected to prior methylation or demethylation [36]. In addition, the chromosomal position of the integrated fragment and other factors affecting its methylation status in the two groups remain unclear [37,38]. Bisulfite sequencing is the most accurate method for analyzing methylation patterns [39]. Consistent with previous studies, our findings showed that the developmental rate of pronuclear-injected oocytes was significantly lower than that of the control groups. Cleavage and blastocyst formation rates were also significantly lower in IVM oocytes than in in vivo-matured oocytes [40,41]. In mouse embryos, Oct4 is uniformly expressed in TE and ICM cells during the early stages of blastulation. However, in late blastocysts, Oct4 expression becomes restricted to ICM cells, where it helps maintain pluripotency; this process is dependent on Dnmt expression [14,15,42]. Increased Dnmt expression is associated with increased methylation, which in turn restricts Oct4 expression [43]. Our data, together with previous findings, indicate that Dnmt expression levels differ between blastocyst-stage embryos derived from IVM- and in vivo-matured oocytes. Specifically, we observed a significant increase in Dnmt3a expression and a nonsignificant decrease in Dnmt3l expression in IVM embryos compared with in vivo embryos. However, Dnmt1 and Dnmt3b expression levels did not differ significantly between the groups [44]. Differences in Dnmt expression may result from variations in methylation patterns [45], the production of different Dnmt isoforms [45,46], or the formation of specific chromatin structures [47,48]. We also evaluated mouse Oct4 expression in both groups using qRT-PCR and immunocytochemical staining. Real-time PCR showed that Oct4 expression was lower in blastocyst-stage embryos derived from IVM oocytes than in those derived from in vivo oocytes, and the difference was significant. Overexpression of Dnmt3a in IVM oocytes may have contributed to increased methylation, thereby reducing OCT4 protein expression in this group. However, because the cDNA used for qRT-PCR was derived from a mixture of all blastocyst cells (ICM+TE), these results may not fully reflect cell type-specific differences. More precise data could be obtained by isolating the ICM and analyzing it at different blastocyst stages [49]. The OCT4 protein is strongly expressed in all embryonic cells during the morula stage, with peak expression occurring in the early blastocyst stage. Its expression decreases in the late blastocyst stage and becomes restricted to ICM cells as its regulatory role in TE cells diminishes [14,15]. Complete silencing of OCT4 is not required for TE cell formation, but its appropriately regulated expression is essential for embryo implantation [50]. Our immunohistochemistry findings in in vivo-matured embryos were consistent with previous studies. In contrast, IVM-derived embryos exhibited higher Oct4 expression in ICM cells during the early blastocyst stage, and expression in TE and ICM cells became more similar as development progressed. Reduced Dnmt3l expression may have affected Dnmt3a activity, thereby preventing extensive methylation and allowing Oct4 expression in both TE and ICM cells during blastocyst progression [14,51].

In conclusion, this study demonstrated that IVM and pronuclear injection were associated with altered OCT4 promoter methylation and changes in the expression levels of Dnmt genes and Oct4 in mouse embryos, likely reflecting environmental differences relative to in vivo-matured oocytes. These findings suggest that DNA methylation during embryonic development plays an important role in the production of high-quality transgenic embryos. However, further research is needed to elucidate additional regulatory mechanisms involved in embryonic development and their implications for transgenesis.

Conflict of interest

No potential conflict of interest relevant to this article was reported.

Acknowledgments

The authors thank the Department of Medical Biotechnology and the Cellular and Molecular Biology Research Center, Shahid Beheshti University of Medical Sciences, for providing laboratory facilities and technical support.

Author contributions

Conceptualization: NP, MS. Methodology: DR, SH, MS. Formal analysis: SH, MS. Data curation: NP, SH. Project administration: MS. Visualization: NP, DR. Writing–original draft: NP, DR. Writing–review & editing: SH, MS. Approval of final manuscript: NP, DR, SH, MS.

Figure 1.

(A) Lanes 1 and 2: phOCT4-enhanced green fluorescent protein (EGFP) plasmid (8,068 bp). (B) Electrophoresis of double-digested phOCT4-EGFP vector. Lane 1: undigested vector; lane 2: BglII single digest; lane 3: NotI single digest; lane 4: BglII/NotI double digest. The DNA molecular weight marker is shown in lane L (100 bp ladder).

Figure 2.

(A) Embryonic development from the two-cell stage to the blastocyst stage: (a) two-cell embryos; (b) four-cell embryos; (c) eight-cell embryos; (d) morula embryos; (e) blastocyst-stage embryos; and (f) hatching blastocysts. (B) Green fluorescent protein expression in blastocysts from (a) the in vivo group, (b) the in vitro oocyte maturation group, and (c) the control groups.

Figure 3.

(A) A comparison of the expression of mouse blastocyst DNA methyltransferase (DNMT) genes in in vitro oocyte maturation (IVM) and in vivo groups. (B) A comparison of the expression of the OCT4 promoter gene in mouse blastocysts in IVM and in vivo groups. (C) The OCT4 promoter methylation level (1) lane 1 and 2: in vivo, lane 3 and 4: in vivo control (2) lane 1: IVM, lane 2 and 3: IVM control. The DNA molecular weight marker is shown in lane L. (100 bp). ^a) Significant difference at p<0.05; ^b)Significant difference at p<0.01.

Figure 4.

(A) Detection of OCT4 protein in cumulus-oocyte complex (COC). Each sample was counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (blue) to visualize nuclei. The images show OCT4 protein in COCs from the in vivo group (a, b) and the in vitro oocyte maturation (IVM) group (c, d). (B) Expression of OCT4 protein at different stages of blastocyst development. Embryos were classified into six groups according to developmental stage, as defined by cell number. In each group, the level and pattern of OCT4 protein expression were evaluated and are presented as the percentage of embryos showing grades I, II, III, and IV OCT4 expression patterns: (a) OCT4 protein expression in blastocysts from the in vivo group and (b) OCT4 protein expression in blastocysts from the IVM group.

Table 1.

Primers used for conventional PCR and real-time PCR

Gene symbol	Primer sequence 5'-------->3'	Product size (bp)
H-OCT4-EGFP	F: CAAGTAAGTGGGGTGGGTAGATGG	4,709
H-OCT4-EGFP	R: GCTCAGGTAGTGGTTGTCG	4,709
M-Hprt1	F: TCCCAGCGTCGTGATTAG	137
M-Hprt1	R: CGAGCAAGTCTTTCAGTCC	137
M-Dnmt3a	F: 5′-CGCCTGGCCCTCTGTGCAAAG-3′	146
M-Dnmt3a	R: 5′-GGTCACTTTCCCTCACTCTGG-3′	146
M-Dnmt3b	F: AACACCCTTTCCATTTCAG	156
M-Dnmt3b	R: GACAGCAAAGTTAAAGAAAGTG	156
M-Dnmt1	F: ACACCGTTCCCGTTCAG	154
M-Dnmt1	R: TCATCCACAGCATCCTCAG	154
M-Dnmt3l	F: GATGACCAAGAGACAACTACCC	96
M-Dnmt3l	R: CCACACCCGCATAGCATTC	96
M-Oct4	F: GGCGTTCTCTTTGGAAAGGTG	207
M-Oct4	R: ACGGTTCTCAATGCTAGTTCG	207

PCR, polymerase chain reaction; H, human; EGFP, enhanced green fluorescent protein; M, mouse; Hprt1, hypoxanthine phosphoribosyltransferase 1; Dnmt3a, DNA methyltransferase 3 alpha; Dnmt3b, DNA methyltransferase 3 beta; Dnmt1, DNA methyltransferase 1; Dnmt3l, DNA methyltransferase 3-like.

Table 2.

Comparison of fertilization, cleavage, and developmental competence rates between IVM and in vivo groups derived from metaphase II oocytes

Group	No. of oocytes	Two‐cell stage	Four‐cell stage	Eight‐cell stage	Morula	Blastocysts
In vivo (control)	105	95.76^a)	94.90^a)	92.25^a)	90.95^a)	86.31^a)
In vivo microinjection	116	69.21^b)	66.85^b)	62.70^b)	61.82^b)	46.62^b)
IVM (control)	151	83.86^c)	51.78^b)	43.42^b)	39.28^b)	27.14^b)
IVM microinjection	220	40.79^d)	27.90^c)	25.94^c)	24.61^c)	16.33^c)

Values are presented as percentage.

IVM, in vitro oocyte maturation.

^a),b),c),d)Significant differences (p<0.05).

References

1. Gordon JW, Scangos GA, Plotkin DJ, Barbosa JA, Ruddle FH. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A 1980;77:7380-4.

2. Hemberger M, Hanna CW, Dean W. Mechanisms of early placental development in mouse and humans. Nat Rev Genet 2020;21:27-43.

3. Wong MPM, Ng RK. Resetting cell fate by epigenetic reprogramming. In: Logie C, Knoch TA, editors. Chromatin and epigenetics. IntechOpen; 2018 [cited 2026 Jun 7]. Available from: [cited 2026 Jun 77]. Available from: https://www.intechopen.com/chapters/63505

4. Kim M, Costello J. DNA methylation: an epigenetic mark of cellular memory. Exp Mol Med 2017;49:e322.

5. Suelves M, Carrio E, Nunez-Alvarez Y, Peinado MA. DNA methylation dynamics in cellular commitment and differentiation. Brief Funct Genomics 2016;15:443-53.

6. Cantone I, Fisher AG. Epigenetic programming and reprogramming during development. Nat Struct Mol Biol 2013;20:282-9.

7. Zeng Y, Chen T. DNA methylation reprogramming during mammalian development. Genes (Basel) 2019;10:257.

8. Guo F, Li X, Liang D, Li T, Zhu P, Guo H, et al. Active and passive demethylation of male and female pronuclear DNA in the mammalian zygote. Cell Stem Cell 2014;15:447-59.

9. Bogdanovic O, Lister R. DNA methylation and the preservation of cell identity. Curr Opin Genet Dev 2017;46:9-14.

10. Loaeza-Loaeza J, Beltran AS, Hernandez-Sotelo D. DNMTs and impact of CpG content, transcription factors, consensus motifs, lncRNAs, and histone marks on DNA methylation. Genes (Basel) 2020;11:1336.

11. Szczepanska K, Stanczuk L, Maleszewski M. Oct4 protein remains in trophectoderm until late stages of mouse blastocyst development. Reprod Biol 2011;11:145-56.

12. Koestenbauer S, Zech NH, Juch H, Vanderzwalmen P, Schoonjans L, Dohr G. Embryonic stem cells: similarities and differences between human and murine embryonic stem cells. Am J Reprod Immunol 2006;55:169-80.

13. Lin L, Li Q, Zhang L, Zhao D, Dai Y, Li N. Aberrant epigenetic changes and gene expression in cloned cattle dying around birth. BMC Dev Biol 2008;8:14.

14. Wu G, Scholer HR. Role of Oct4 in the early embryo development. Cell Regen 2014;3:7.

15. Ovitt CE, Scholer HR. The molecular biology of Oct-4 in the early mouse embryo. Mol Hum Reprod 1998;4:1021-31.

16. Sabry R, Saleh AC, Stalker L, LaMarre J, Favetta LA. Effects of bisphenol A and bisphenol S on microRNA expression during bovine (Bos taurus) oocyte maturation and early embryo development. Reprod Toxicol 2021;99:96-108.

17. Liu J, He B, Yin C, Chang Z, Zhao R. Transcriptomic responses of porcine cumulus cells to heat exposure during oocytes in vitro maturation. Mol Reprod Dev 2021;88:43-54.

18. Herceg Z, Vaissiere T. Epigenetic mechanisms and cancer: an interface between the environment and the genome. Epigenetics 2011;6:804-19.

19. Egashira J, Ihara Y, Khatun H, Wada Y, Konno T, Tatemoto H, et al. Efficient in vitro embryo production using in vivo-matured oocytes from superstimulated Japanese Black cows. J Reprod Dev 2019;65:183-90.

20. Hatırnaz S, Ata B, Hatırnaz ES, Dahan MH, Tannus S, Tan J, et al. Oocyte in vitro maturation: a systematic review. Turk J Obstet Gynecol 2018;15:112-25.

21. Tan K, An L, Miao K, Ren L, Hou Z, Tao L, et al. Impaired imprinted X chromosome inactivation is responsible for the skewed sex ratio following in vitro fertilization. Proc Natl Acad Sci U S A 2016;113:3197-202.

22. Obata Y, Kono T, Hatada I. Gene silencing: maturation of mouse fetal germ cells in vitro. Nature 2002;418:497.

23. Milroy C, Liu L, Hammoud S, Hammoud A, Peterson CM, Carrell DT. Differential methylation of pluripotency gene promoters in in vitro matured and vitrified, in vivo-matured mouse oocytes. Fertil Steril 2011;95:2094-9.

24. Lou H, Le F, Hu M, Yang X, Li L, Wang L, et al. Aberrant DNA methylation of IGF2-H19 locus in human fetus and in spermatozoa from assisted reproductive technologies. Reprod Sci 2019;26:997-1004.

25. Jurema MW, Nogueira D. In vitro maturation of human oocytes for assisted reproduction. Fertil Steril 2006;86:1277-91.

26. Rezaee D, Hosseini S, Jajarmi V, Salehi M. Efficient of toll-like receptor 4 knockout in mouse zygotes by CRISPER/Cas9. Nov Biomed 2021;9:132-7.

27. Rezaee D, Bandehpour M, Kazemi B, Hosseini S, Dehghan Z, Bastaminejad S, et al. Effects of human chorionic gonadotropin-producing peripheral blood mononuclear cells on the endometrial receptivity and implantation sites of the mouse uterus. Clin Exp Reprod Med 2022;49:248-58.

28. Dehghan Z, Mohammadi-Yeganeh S, Rezaee D, Salehi M. MicroRNA-21 is involved in oocyte maturation, blastocyst formation, and pre-implantation embryo development. Dev Biol 2021;480:69-77.

29. Rezaee D, Bandehpour M, Kazemi B, Bastaminejad S, Najafi S, Salehi M. Cytokine changes and embryo attachment in mouse endometrial cells following treated with peripheral blood mononuclear cells (PBMCs) expressing ectopic hCG, and hCG–activated PBMCs. Asian Pac J Reprod 2023;12:90-6.

30. Krisher RL. In vivo and in vitro environmental effects on mammalian oocyte quality. Annu Rev Anim Biosci 2013;1:393-417.

31. Tarin JJ, Garcia-Perez MA, Cano A. Assisted reproductive technology results: why are live-birth percentages so low? Mol Reprod Dev 2014;81:568-83.

32. Hirasawa R, Chiba H, Kaneda M, Tajima S, Li E, Jaenisch R, et al. Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development. Genes Dev 2008;22:1607-16.

33. Emura N, Sakurai N, Takahashi K, Hashizume T, Sawai K. OCT-4 expression is essential for the segregation of trophectoderm lineages in porcine preimplantation embryos. J Reprod Dev 2016;62:401-8.

34. Chen Z, Zhang Y. Role of mammalian DNA methyltransferases in development. Annu Rev Biochem 2020;89:135-58.

35. Greenberg MV, Bourc'his D. The diverse roles of DNA methylation in mammalian development and disease. Nat Rev Mol Cell Biol 2019;20:590-607.

36. Stocum DL, Zupanc GK. Stretching the limits: stem cells in regeneration science. Dev Dyn 2008;237:3648-71.

37. Jopling C, Boue S, Izpisua Belmonte JC. Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol 2011;12:79-89.

38. Doerfler W, Bohm P. DNA methylation: basic mechanisms. Springer Science & Business Media; 2006.

39. Feng S, Zhong Z, Wang M, Jacobsen SE. Efficient and accurate determination of genome-wide DNA methylation patterns in Arabidopsis thaliana with enzymatic methyl sequencing. Epigenetics Chromatin 2020;13:42.

40. Wang N, Le F, Zhan QT, Li L, Dong MY, Ding GL, et al. Effects of in vitro maturation on histone acetylation in metaphase II oocytes and early cleavage embryos. Obstet Gynecol Int 2010;2010:989278.

41. Liu XY, Mal SF, Miao DQ, Liu DJ, Bao S, Tan JH. Cortical granules behave differently in mouse oocytes matured under different conditions. Hum Reprod 2005;20:3402-13.

42. Hu YG, Hirasawa R, Hu JL, Hata K, Li CL, Jin Y, et al. Regulation of DNA methylation activity through Dnmt3L promoter methylation by Dnmt3 enzymes in embryonic development. Hum Mol Genet 2008;17:2654-64.

43. Kellner S, Kikyo N. Transcriptional regulation of the Oct4 gene, a master gene for pluripotency. Histol Histopathol 2010;25:405-12.

44. Uysal F, Ozturk S, Akkoyunlu G. DNMT1, DNMT3A and DNMT3B proteins are differently expressed in mouse oocytes and early embryos. J Mol Histol 2017;48:417-26.

45. Hara S, Takano T, Fujikawa T, Yamada M, Wakai T, Kono T, et al. Forced expression of DNA methyltransferases during oocyte growth accelerates the establishment of methylation imprints but not functional genomic imprinting. Hum Mol Genet 2014;23:3853-64.

46. Duymich CE, Charlet J, Yang X, Jones PA, Liang G. DNMT3B isoforms without catalytic activity stimulate gene body methylation as accessory proteins in somatic cells. Nat Commun 2016;7:11453.

47. Karemaker ID, Baubec T. DNA methyltransferases hitchhiking on chromatin. Swiss Med Wkly 2020;150:w20329.

48. Vassena R, Dee Schramm R, Latham KE. Species-dependent expression patterns of DNA methyltransferase genes in mammalian oocytes and preimplantation embryos. Mol Reprod Dev 2005;72:430-6.

49. Xu J, Li Y, Xu Y, Ding C, Li T, Zhou C. A simple and effective method for the isolation of inner cell mass samples from human blastocysts for gene expression analysis. In Vitro Cell Dev Biol Anim 2014;50:232-6.

50. Celauro E, Mukaj A, Fierro-Gonzalez JC, Wittung-Stafshede P. Copper chaperone ATOX1 regulates pluripotency factor OCT4 in preimplantation mouse embryos. Biochem Biophys Res Commun 2017;491:147-53.

51. Veland N, Lu Y, Hardikar S, Gaddis S, Zeng Y, Liu B, et al. DNMT3L facilitates DNA methylation partly by maintaining DNMT3A stability in mouse embryonic stem cells. Nucleic Acids Res 2019;47:152-67.